Executive Producers: Jim Lavin Sir Otaku of the Wooden Mash Paddle, Sir Gerald Gionet, Anonymous, Sir Gadget Virtuoso Matthew Stevens, Sir Andrew Largeman, Sir Brian Ferguson, Dale Thorton
Associate Executive Producers: Parry Emsberger, Carter Pelham
Contest Winners: Ryan Gielo, Computer Systems Solutions/DH Slammer, Micky Keck
Become a member of the 641 Club, support the show here
The following is a draft of an essay, eventually for publication as part of the Digital Keywords project (Ben Peters, ed). This and other drafts will be circulated on Culture Digitally, and we invite anyone to provide comment, criticism, or suggestion in the comment space below. We ask that you please do honor that it is being offered in draft form '-- both in your comments, which we hope will be constructive in tone, and in any use of the document: you may share the link to this essay as widely as you like, but please do not quote from this draft without the author's permission. (TLG)
Sharing '-- Nicholas A. John, The Hebrew University of Jerusalem
''Sharing,'' in digital contexts, can simply refer to the transfer of data from one place to another, or to making some data available to other people or machines. This is certainly how the term was used in describing the various arrangements by which data was transported between the entities and programs exposed by Edward Snowden in the summer of 2013. However, while ''data sharing'' would not appear to be a controversial term in any way, the same certainly cannot be said of ''file sharing,'' despite its equally deep roots in the field of computing. File sharing, assert certain representatives of the state and the entertainment industry, is not sharing, but rather theft. Critical voices of quite a different ilk might point out that Facebook, Google and the rest do not ''share'' information about users with third parties, which is the language used in such companies' privacy statements; rather, and more linguistically accurately, they sell it. Both of these objections to the use of the word ''sharing'' '' despite their quite different political motivations '' are equally revealing. What they reveal is that, for many people, sharing is a cherished notion which must not be sullied; some things may properly be described as sharing, but others most certainly may not.
In discussing ''sharing'' as a digital keyword, though, we must look beyond these criticisms of the word's use and search for a richer understanding of its workings as a metaphor that saturates our usage of information and communication technologies (ICTs) today. For the next few pages, we shall not be concerned with whether this or that activity is really sharing. What is important is that it is called sharing. ''Sharing'' is an important digital keyword not only because of its roots in computing (time sharing, disk sharing, file sharing, etc.), but because it bears the promise that today's network and mobile technologies '' because they make it easier for us and encourage us to share extensively '' will bring about a better society. Given the myriad creative ways in which precisely these technologies are used to challenge the powerful and offer alternative ways of doing things, this is a promise that should not be too perfunctorily dismissed. Nor, of course, should it be naively accepted.
As a keyword of the digital age, ''sharing'' is the constitutive activity of Web 2.0, or the interactive, user-generated internet. It is what we do on social network sites (SNSs); it is the name given to the act of distributing data (photos, links, videos, tweets, etc.) through electronic networks; it is what we do when leaving a review on Amazon (''Share your thoughts,'' says the site) or uploading a movie to YouTube; it is the act of updating our status on Facebook or checking in on Foursquare; all of these, and more, come under the extremely broad umbrella of ''sharing.''
The word ''sharing'' has a history, even within the context of social network sites. To understand something of this history, I analyzed the emergence and development of the word ''sharing'' in 44 different SNSs from 1999 to 2010 (since when I have not noted any significant changes). [1] The overall trend in the usage of the word is from the specific to the far more general, and the introduction of the word to describe existing activities that had previously been called something else (posting, sending, updating, etc.). We have also witnessed the introduction of a communicative logicof sharing, in addition to its distributive logic.
In the early 2000s, when we shared something on a social network site, the object of our sharing was clearly defined: we were invited to share web links and photos and the like. However, from 2007 (and not before), on their home pages SNSs started urging us to share what I call ''fuzzy objects of sharing,'' which included things such as ''your life,'' ''your world,'' or ''the real you.'' I call these fuzzy objects of sharing because it is not explicitly clear what it is that we are meant to share. I understand what it means to share photos or videos, but what exactly does it mean to ''share your world''? When the object of sharing is fuzzy, the act of sharing online becomes far broader and includes many more behaviors. Sharing your world implies letting other people know as much as possible about what you are doing, thinking, and, importantly, feeling. Its vagueness '' or fuzziness '' enables its comprehensiveness.
Another innovative use of the term ''share'' in SNSs, which also reflects its increasing generalization, was that it began to be used without any object at all, but simply on its own, sometimes as part of the site's self-description (in texts that might read, ''On this site you can share with your friends''), and sometimes in the form of an imperative (''Share!''). This represents an important stage in the short history of the keyword, ''share,'' in the context of Web 2.0, as it indicates to us that SNSs users were now assumed to know what sharing is without having to be told what to share. Significantly for a historically-informed understanding of this keyword, none of the SNSs that I analyzed used the word ''share'' without an object prior to 2005 (which is to suggest that if this book had been published on the 30th anniversary of Williams' text, the inclusion of ''sharing'' as a digital keyword would not have felt quite so natural as it does now, on the 40th anniversary).
Thirdly, in the second half of the 2010s, as ''sharing'' became the word to describe our participation in SNSs (and recall that Facebook opened its doors to all comers in October 2006), a number of sites started replacing words such as ''update,'' ''post,'' and ''send'' with ''share.'' The functionality of these sites had not changed, but their rhetoric did. This reflects the ascension of ''sharing'' to its current position as the constitutive activity of Web 2.0: not only did SNSs feel that users were now familiar enough with them that they could talk of sharing without indicating what is to be shared, they recognized that if they were not describing themselves in terms of sharing, they had better start to do so; they recognized that ''sharing'' is the name of the game, and if they want to position themselves within the booming SNS industry, they had better be in the business of sharing. Hence, for instance, on the photo-sharing SNS, Fotolog, the tag line, ''Make it easy for friends/ family to see what's up with you'' was replaced with, ''Share your world with the world.''
''Sharing,'' though, is not just the keyword for social network sites. It refers to the range of digitally-mediated communication. Thus, for instance, mobile service provider, T-Mobile, ran an ad campaign with the tag line, ''Life's for Sharing.'' As noted above, this usage of the word ''sharing'' can be dismissed as ideological. Commercial enterprises are trying to entice us to use their services by cloaking them in a language of altruism and concern for others, runs the argument, whereas ''sharing'' (and here the scare marks become particularly pertinent) only serves the companies' bottom line and makes us even more narcissistic. But if we dig deeper into this keyword, we can see it as bearing the promise of the digital era, as the new meanings of sharing just outlined merge with the older and almost exclusively positively valenced meanings of the term. Sharing, as I shall attempt to briefly show, then becomes the model for a digitally-based readjustment of our interactions with things (sharing instead of owning) and with one another (sharing as the form of communication on which our relationships '' especially, but not exclusively, romantic ones '' are based). In order to make this point, though, we need to go back further than the invention of social network sites.
In its non-metaphorical sense, to share is to divide. The ploughshare rents the earth asunder; ''share'' and ''shear'' were once the same word, with their roots in the Old English, ''scearu.''[2] When a child shares their candies, she divides them between her and her friends; when a child shares a toy with another, he gives that child joint access to the toy; also, if I own shares in a publicly-owned company, I own part of that company. Sharing, then, at least from the 16th century, is about distribution '' both dividing stuff up, and giving more than one person access to the same thing, while the word would seem to be agnostic about the object of sharing. There are rules and norms for sharing which are not wildly divergent from those that govern gifting '' there is an implicit expectation of reciprocity, for instance (''if you don't ever share your candies with me, I'll stop sharing mine with you''). Similarly to gifting, sharing also creates and sustains social ties.[3] Some things we share actively and voluntarily; other things we share passively and by necessity '' including infrastructures, public spaces, or even our planet.[4]
More recently '' that is, within the last 100 years or so '' in addition to referring to distribution, sharing has taken on a more abstract communicative dimension. Here, sharing is a category of speech, a type of talk, that is particularly characterized by openness and honesty, and with which we might also associate such values as trust, reciprocity, equality and intimacy, among others. This is the sharing for which AA members are thanked after telling the group about their struggles with the bottle; it is the sharing referred to by Beck and Beck-Gernsheim (1995) in their characterization of the modern, or pure, relationship as based on ''a couple sharing emotions,'' and as no longer based on a family ''sharing the work'' (p. 48); it is the sharing described by Donal Carbaugh (1988) in his ground-breaking work on Donahue in the mid-1980s. This type of sharing '' which clearly resonates with assumptions about the self, and how it must communicate itself and with others, that characterize our so-called therapeutic culture '' has its roots in the Oxford Group, an early-20th century Christian group that gave birth to the pre-WWII Moral Rearmament movement and to Alcoholics Anonymous. Sharing, in the Oxford Group, was the public confession of sins, or to put it in terms that show its current relevance, the public declaration of weakness for the sake of redemption. Sharing thus understood is the communication of a deep personal truth, and, in the Oxford Group, was perceived as the bedrock of man's relationship with God, but also, and perhaps primarily, with other people (especially one's spouse). Even to the religious leaders of the Oxford Group the psychological aspects of sharing were quite clear: sharing made you feel better; it contributed to your well-being.
Today, the category of speech we call ''sharing'' tends to involve the communication of emotions and the word itself functions as what speech act theorists call a metalinguistic performative verb, or illocutionary force indicating device '' meaning that it tells us what kind of speech is about to follow. Put simply, if someone tells us they have something they would like to share with us, we will get ready to hear something personal, something of emotional import, and not, for instance, that the toothpaste has run out. This sense of sharing '' as the type of communication on which contemporary friendships and intimate relationships are based '' is part of the metaphor of sharing in the context of SNSs and in its digital sense more generally.
The final sense of sharing that informs its multi-layered meaning as a digital keyword harks back to its distributive logic, and is found in the neologism, ''the sharing economy.'' The sharing economy incorporates elements of both production (think Wikipedia and Linux) and consumption (think Couchsurfing and Zipcar), and is constructed as a predominantly online and technological phenomenon. An analysis of 63 newspaper articles about ''collaborative consumption'' published between May 2010 and April 2012, for instance, shows technology to be central to this phenomenon, both in enabling new ways of distributing goods (searchable and geo-tagged databases make it easier to locate and therefore borrow your neighbor's power drill) and, interestingly, in driving new/old sharing behaviors. Here, a causal argument is sometimes posited that sharing online (updating statuses, tweeting, etc.) leads people to want to share offline. Regardless of the empirical accuracy or otherwise of this claim, sharing is represented as a more moral and environmentally-friendly alternative to capitalist models of production and consumption. It plays heavily on interpersonal relations, promising to introduce you to your neighbors, for instance, or to reinstate the sense of community that has been driven out by the alienated lifestyle characteristic of the city. It conceptualizes sociality in terms of mutuality, openness, trust, commonality, and, to a degree, equality.
This, then, is the final component of sharing as a digital keyword. It is an important component, both because it relates us back to our most intuitive sense of what sharing is '' distributing stuff among people in a fair way '' and also because it helps to infuse the notion of sharing with its utopianism. Indeed, whatever we may think of sharing online, we would be hard pushed to think of any kind of good society in which (offline) sharing did not feature prominently '' in both its distributive and communicative senses. More than this: those who say that what we do on Facebook is ''not really sharing'' are trying to protect the word from the deleterious influences of commercialism.[5]
As I hope is clear by now, my objective here is not to call the tech companies out for hypocrisy, and I am not overly concerned with what is and is not considered ''really sharing.'' In trying to understand ''sharing'' as a keyword, I am far more interested in the ways in which the term works as a metaphor, how it ''organize[s] our thoughts and actions,'' as Lakoff and Johnson put it (Lakoff & Johnson, 1980, p. 40). When we call our digital interactions ''sharing,'' this encapsulates the promise of our generation's technologies, just as the telegraph, the radio and the television came with their promises too. The promise of sharing is (at least) twofold. One the hand, there is the promise of honest and open (computer-mediated) communication between individuals; the promise of knowledge of the self and of the other based on the verbalization of our inner thoughts and feelings. On the other hand, there is the promise of improving what many hold to be an unjust state of affairs in the realms of both production and consumption; the promise of an end to alienation, exploitation, self-centered greed, and breathtaking wastefulness. For some the incongruity is too much, but these are the associations with sharing that tech companies seek to be identified with, and that utopianists '' the vast majority of whom do not have a stake in the success or failure of this or that platform '' think will be realized as a result of the deeper embedding of social media in our everyday lives. For them, the internet really does promise improved sociability and really is the technological key to a better society through the spread of the (technology-driven) sharing economy. The concept of sharing represents both a set of values and a set of practices such that the latter, it is claimed, will help us achieve the former. As a keyword for the digital age, ''sharing'' bears the promise for a better society, while requiring us always to keep in mind the political economy of the structures '' digital and otherwise '' through which we carry out our various practices of sharing.
Notes
1. The methodology for and detailed results from this research can be found in (John, 2013a).
2. Even this sense of sharing may be metaphorical, as perhaps the earliest use of the word was to refer to the groin, where the trunk of the body divides into two legs.
3. This is described superbly in Tamar Katriel's ethnography of how Israeli children share candies (Katriel, 1987).
4. For brevity's sake, I am eliding two senses of sharing '' sharing as dividing, and sharing as having in common. Both of these senses fall within what I call the distributive logic of sharing (for more, see John, 2013b).
5. I do not have the space here to explore the idea that the high-tech entrepreneurs behind today's tech behemoths also feel a commitment to an ethos of sharing (normatively understood). If I did I would discuss Yuval Dror's work on how some high-tech companies (including Facebook) claim that they are not in it for the money (Dror, 2013) and Fred Turner's exploration of the link between Google and the antiestablishmentarianism of the Burning Man festival (Turner, 2009). I would also most likely discuss Barbrook and Cameron's polemic against the ''Californian ideology'' (Barbrook & Cameron, 1996).
References
Barbrook, R., & Cameron, A. (1996). The Californian Ideology. Science as Culture, 6(1), 44-72.
Beck, U., & Beck-Gernsheim, E. (1995). The normal chaos of love. Cambridge, UK: Polity Press.
Carbaugh, D. A. (1988). Talking American: Cultural discourses on Donahue. Norwood, N.J.: Ablex Pub. Corp.
Dror, Y. (2013). 'We are not here for the money': Founders' manifestos. New Media & Society, 1461444813506974.
John, N. A. (2013a). Sharing and Web 2.0: The emergence of a keyword. New Media & Society, 15(2), 167-182. doi: 10.1177/1461444812450684
John, N. A. (2013b). The Social Logics of Sharing. The Communication Review, 16(3), 113-131. doi: 10.1080/10714421.2013.807119
Katriel, T. (1987). ''Bexib¹dim!'': Ritualized sharing among Israeli children. Language in society, 16(03), 305-320.
Lakoff, G., & Johnson, M. (1980). Metaphors we live by. Chicago: University of Chicago Press.
Turner, F. (2009). Burning Man at Google: a cultural infrastructure for new media production. New Media & Society, 11(1-2), 73-94.
-Contributed by Nicholas John, -
Posted in Uncategorized | Tagged digital culture, digital keywords, draft, sharing | Comments Off
induce a sense of disbelief or alienation in someone.Weird | Define Weird at Dictionary.cominvolving or suggesting the supernatural; unearthly or uncanny: a weird sound;weird lights. 2. fantastic; bizarre: a weird getup. 3. Archaic. concerned with or ...Urban Dictionary: weird1. adj u would call someone who is strange 2. (better definition) horny/kinky. 1.My girlfriend called me weird :( 2. My girlfriend called me weird ;). by eat my ear ...Weird - Definition and More from the Free Merriam-Webster DictionaryMiddle English wird, werd, from Old English wyrd; akin to Old Norse urthr fate,Old English weorthan to become '-- more at worth. First Known Use: before 12th ...weird: definition of weird in Oxford dictionary (American English) (US)www.oxforddictionaries.com/us/definition/american_english/weird- Cached - SimilarDefinition of weird in American English in Oxford dictionary. Meaning,pronunciation and example sentences. English to English reference content (US).weird - definition of weird by The Free DictionaryOf, relating to, or suggestive of the preternatural or supernatural. 2. Of a strikinglyodd or unusual character; strange. 3. Archaic Of or relating to fate or the Fates.weird - definition. American English definition of weird by Macmillan ...www.macmillandictionary.com/us/dictionary/american/weird- Cached - SimilarDefine weird in American English. What is weird? weird meaning and more byMacmillan Dictionary.Definition of weird - Merriam-Webster's Student Dictionarywww.wordcentral.com/cgi-bin/student?book=Student&va=weird- Cached - SimilarMain Entry: weird. Pronunciation: primarystress wi( schwa )rd. Function: adjective. Etymology: Old English wyrd (noun) "fate" 1 : of, relating to, or caused by ...weird - WordReference.com Dictionary of Englishweird - WordReference English dictionary, questions, discussion and forums. AllFree. ... "Woven with" - weird definition · "You are truly missed." Sounds weird?Weird dictionary definition | weird defined - YourDictionaryThe definition of weird is relating to the supernatural or strange or unconventional. An example of weird are the witches in Macbeth. An example of weird is ...weird - Collins English Dictionary | Always Free Onlinewww.collinsdictionary.com/dictionary/english/weird- Cached - SimilarYou are here; > Home; > English Dictionary; > Definition of ''weird'' ... It must beweird to suddenly become rich.wɪÉd ADJECTIVE; Arabic: عÙجÙÙب Pronunciation ...
Unnamed individual will be cared for in specially designed isolation unit, Atlanta hospital says
WebMD News from HealthDay
By Dennis Thompson and E.J. Mundell
HealthDay Reporters
FRIDAY, Aug. 1, 2014 (HealthDay News) -- An American who is battling the Ebola virus in West Africa will be flown to the United States for treatment over the next few days, according to staff at Emory University Hospital in Atlanta.
The name of the patient is not yet being released, but there are two known American patients currently fighting Ebola in medical centers in Monrovia, Liberia: Dr. Kent Brantly, 33, and Nancy Writebol, 59. Both had been working at clinics in Liberia, helping victims of an outbreak that the World Health Organization says has already killed at least 729 people.
Both patients are described as being in stable but grave condition.
According to NBC News, Emory said Thursday that it was preparing a special isolation ward to receive the Ebola patient "within the next several days."
A plane rigged with special equipment designed to contain the virus and care for the patient during flight will carry the individual to Atlanta, with help from the U.S. Centers for Disease Control and Prevention, NBC News reported.
A State Department spokesman told the news network that, "The CDC has devised plans and equipment to do it safely. Patients were evacuated in similar ways during the SARS outbreak in 2003 and in cases involving drug-resistant tuberculosis in 2007."
According to Emory, the patient will be cared for in a special isolation unit with ""equipment and infrastructure that provide an extraordinarily high level of clinical isolation." The hospital told NBC that its staff is regularly trained "in the specific and unique protocols and procedures necessary to treat and care for this type of patient."
There's no cure or vaccine for Ebola, which wreaks life-threatening havoc on the body by attacking multiple organ systems simultaneously.
Instead, doctors must fall back on the basics of "good, meticulous intensive care," supporting the patient and targeting treatment toward organs that are under attack, explained Dr. Lee Norman, chief medical officer for the University of Kansas Hospital and an expert on the disease.
"You treat the things that are failing," Norman said. "If a person is dehydrated, you treat them with IV fluid support. If a person has respiratory failure, you put them on a ventilator."
As the disease progresses, the impact in terms of illness is "additive," Norman noted. "Every time you add another organ system that's failing, a person's chance of survival goes down exponentially."
The human body responds to this multiple-pronged attack by initiating a massive and intense inflammatory response -- which actually adds to the damage being done, Hirsch noted.
"It's a combination of the viral destruction and the inflammation that takes place in response that's so life-threatening to us," he said.
Does it make sense we brought an Ebola patient to the USA? Is that normal procedure?
Point one: the press release of 31 July 2014 references the 2003 EO 13295 of GW Bush.
That one added a blurb about SARS (see section b).
However, the 2003 order already included Ebola (see section a).
What is amazing about the 2003 order is that Ebola was part of a list of "Viral Hemorrhagic Fevers" (VHFs). And note, that list is open-ended, as it allows for quarantine for other VHFs "not yet isolated or named."
Point two: Please appreciate that though the 2003 order added SARS, the language of the EO specifically exempted influenza.
In 2005 however, EO 13375 ADDED section (c) which included so-called influenza viruses that cause or have the potential to cause a pandemic. (See attachment).
What a surprise that in 2009 we got the H1N1 scare and the WHO claiming a level 6 pandemic!
Point three: the new Obama EO of 2014 makes no reference to section (c) of the 2005 EO 13375. Rather it excises the SARS language from section (b) - as to make application of the quarantine broader.
And though some people might feel relieved about the influenza exception in section (b) of this 2014 press release (and coming official EO), section (c) from the 2005 EO 13375 is still in effect!
Point four: the Obama EO includes the purposes of the 2003 Bush EO 13295.
The purpose of that and now this order (as stated in Section 1) is: "specifying certain communicable diseases for regulations providing for the apprehension, detention, or conditional release of individuals to prevent the introduction, transmission, or spread of suspected communicable diseases ..."
As we can imagine, a first beta test for conditional release will include many people (called illegal immigrants or undocumented persons) currently housed at federal detention centers in places like San Antonio.
(Fox News says that immigrants are spreading swine flu and TB in Austin and Lackland Air Force Base in San Antonio): http://www.foxnews.com/opinion/2014/07/07/immigration-crisis-tuberculosis-spreading-at-camps/ - 2014 July 07 with video, 3:40)
(Judicial Watch says that the immigrants have Ebola, Dengue fever, TB, and swine flu - 2014 July 08. http://www.judicialwatch.org/blog/2014/07/illegal-alien-minors-spreading-tb-ebola-dengue-swine-flu/)
And the Daily Caller, 2014 Aug 01, "immigrants spreading scabies in holding facilities." http://dailycaller.com/2014/07/31/dhs-report-tuberculosis-and-scabies-spreading-in-migrant-holding-facilities/ (44 second video - alluding to the idea that people need booster shots for Chicken Pox and TB)
I figure that the FEMA camp folks are all ready to inject political dissidents, er, potential suspected disease carriers, with life saving vaccines - new and experimental, er improved.
Maybe we can avoid the detention centers by getting our shots early? Take your meds (shots) slaves!
Best
Dr. Jones
Executive Order -- Revised List of Quarantinable Communicable Diseases | The White House
EXECUTIVE ORDER - - - - - - - REVISED LIST OF QUARANTINABLE COMMUNICABLE DISEASES
By the authority vested in me as President by the Constitution and the laws of the United States of America, including section 264(b) of title 42, United States Code, it is hereby ordered as follows: Section 1. Amendment to Executive Order 13295. Based upon the recommendation of the Secretary of Health and Human Services, in consultation with the Acting Surgeon General, and for the purposes set forth in section 1 of Executive Order 13295 of April 4, 2003, as amended by Executive Order 13375 of April 1, 2005, section 1 of Executive Order 13295 shall be further amended by replacing subsection (b) with the following: "(b) Severe acute respiratory syndromes, which are diseases that are associated with fever and signs and symptoms of pneumonia or other respiratory illness, are capable of being transmitted from person to person, and that either are causing, or have the potential to cause, a pandemic, or, upon infection, are highly likely to cause mortality or serious morbidity if not properly controlled. This subsection does not apply to influenza." Sec. 2. General Provisions. (a) Nothing in this order shall be construed to impair or otherwise affect: (i) the authority granted by law to an executive department, agency, or the head thereof; or (ii) the functions of the Director of the Office of Management and Budget relating to budgetary, administrative, or legislative proposals. (b) This order is not intended to, and does not, create any right or benefit, substantive or procedural, enforceable at law or in equity by any party against the United States, its departments, agencies, or entities, its officers, employees, or agents, or any other person.
The Model State Emergency Health Powers Act (MSEHPA) is a proposed act written by the Center for Law and the Public's Health, a collaboration of Georgetown University and Johns Hopkins University, to help America's state legislatures in revising their public health laws to control epidemics and respond to bioterrorism.
The initial proposal was drafted at the request of the Centers for Disease Control and Prevention by Lawrence O. Gostin, an attorney in Washington, D.C. during the anthrax letter attacks in 2001. Gostin stated that is took him three to four weeks to prepare the act.
The draft, dated October 23, 2001, was produced by Gostin, naming the National Governors Association, the National Conference of State Legislatures, the National Association of Attorneys General, the Association of State and Territorial Health Officials, and the National Association of County and City Health Officials as collaborators without Gostin contacting the aforementioned organizations. A later version, dated December 21, 2001, made the revised statement on its title page that the law was a "draft for discussion '... to assist" those organizations.[1]
Criticism[edit]Critics said, however, that it did so in such sweeping language that it "could turn governors into dictators" as the Association of American Physicians and Surgeons claimed, and Phyllis Schlafly called it "an unprecedented assault on the constitutional rights of the American people."
But attorneys Jason W. Sapsin, Stephen P. Teret; Scott Burris, Julie Samia Mair, James G. Hodge Jr, Jon S. Vernick and Gostin wrote in an article in the August 2002 issue of the Journal of the American Medical Assn., that "Provided those powers are bounded by legal safeguards, individuals should be required to yield some of their autonomy, liberty, or property to protect the health and security of the community."[2]
Current status[edit]As of 2007, 33 states had introduced 133 legislative bills or resolutions that are based upon or feature provisions related to the articles or sections of the act. Of these bills, 48 had passed.[3]
References[edit]^"The Model State Emergency Health Powers Act". The Center for Law and the Public's Health. 2001. Retrieved November 19, 2013. ^Gostin, Lawrence; Sapsin, Jason; Teret, Stephen; Burris, Scott; Samia Mair, Julie; Hodge, James; Vernick, Jon (August 7, 2002). "The Model State Emergency Health Powers Act: Planning for and Response to Bioterrorism and Naturally Occurring Infectious Diseases". JAMA288 (5): 622''628. doi:10.1001/jama.288.5.622. Retrieved 17 November 2013. ^"The Turning Point Model State Public Health Act: State Legislative Update Table". The Center for Law and the Public's Health. 2007. Retrieved November 19, 2013. George J. Annas. "Bioterrorism and Public Health Law" (letter). Journal of the American Medical Association. vol. 288 n. 21. December 4, 2002. 2685-2686.George J. Annas. "Bioterrorism, Public Health, and Civil Liberties." New England Journal of Medicine. vol. 346, no. 17. April 25, 2002. 1337-1341. (Letters responding in vol. 347, no. 1, September 12, 2002.)George J. Annas. "Terrorism and Human Rights" In In the Wake of Terror: Medicine and Morality in a Time of Crisis. Jonathan D. Moreno, editor. Basic Bioethics Series. Cambridge, Massachusetts: The MIT Press, 2003.Joseph Barbera, Anthony Macintyre, Larry Gostin, Tom Inglesby, Tara O'Toole, Craig DeAttey, Kevin Tonat, and Marti Layton. "Large-scale Quarantine Following Biological Terrorism in the United States: Scientific Examination, Logistics, and Legal Leimits and Possible Consequences." Journal of the American Medical Association. vol. 286, no. 21. December 5, 2001. 2711-2717.Ronald Bayer and James Colgrove. "Rights and Dangers: Bioterrorism and the Ideolgies and Public Health." In In the Wake of Terror: Medicine and Morality in a Time of Crisis. Jonathan D. Moreno, editor. Basic Bioethics Series. Cambridge, Massachusetts: The MIT Press, 2003.John M. Colmers and Daniel M. Fox. "The Politics of Emergency Health Powers and the Isolation of Public Health." American Journal of Public Health. vol. 93, no. 3. March 2003. 397-399.Larry Copeland. "CDC Proposes Bioterrorism Laws." USA Today. November 8, 2001. 3A.Janlori Goldman. "Balancing in a Crisis?: Bioterrorism, Public Health, and Privacy." In Lost Liberties: Ashcroft and the Assault on Personal Freedom. Cynthia Brown, editor. New York: The New Press, 2003.Lawrence O. Gostin. "Law and Ethics in a Public Health Emergency." Hastings Center Report. vol. 32, no. 2. March''April 2002. 9-11.Lawrence O. Gostin, Jason W. Sapsin, Stephen P. Teret, Scott Burris, Julie Samia Mair, James G. Hodge, Jr., and Jon S. Vernick. "The Model State Emergency Powers Act: Planning for and Response to Bioterrorism and Naturally Occurring Infectious Diseases." Journal of the American Medical Association. vol. 288, no. 5. August 7, 2002. 622-628.Lawrence O. Gostin and James G. Hodge, Jr. "Protecting the Public's Health in an Era of Bioterrorism." In In the Wake of Terror: Medicine and Morality in a Time of Crisis. Jonathan D. Moreno, editor. Basic Bioethics Series. Cambridge, Massachusetts: The MIT Press, 2003.Lawrence O. Gostin and James G. Hodge, Jr. "Public Health Emergencies and Legal Reform: Implications for Public Health Policy and Practice." Public Health Reports. vol. 118, no. 5. September''October 2003. 477-479.Lawrence O. Gostin. "Public Health Law in an Age of Terrorism: Rethinking Individual Rights and Common Goods." Health Affairs (Millwood). vol. 21, no. 6. November''December 2002. 79-83."Legislation would let governors quarantine entire cities." Knight Ridder News Service. November 7, 2001.Sharon Lerner. "A New Health-Emergency Law Raises Concerns for the Immune Compromised: Round Up the Unusual Suspects". The Village Voice. January 2, 2002.William Martin. "Legal and Public Policy Responses of States to Bioterrorism." American Journal of Public Health. Vol.94, Iss. 7. July 2004. 1093Thomas May. "Political Authority in a Bioterrorism Emergency." Journal of Law, Medicine, and Bioethics. vol. 31, no. 1. Spring 2004. 159-164.Jane M. Orient. "Bioterrorism and Public Health Law" (letter). Journal of the American Medical Association. vol. 288 n. 21. December 4, 2002. 2686."Outside Experts: Lawrence O. Gostin." Government Executive. February 2004. 110.External links[edit]
If there's an Ebola vaccine that works on monkeys, then what about humans?
The CDC released this map of the 2014 Ebola Hemorrhagic Fever outbreak in Guinea, Liberia and Sierra Leone.
Tuesday's death of Sheik Umar Khan, the doctor at the front lines of Sierra Leone's battle against the worst Ebola outbreak in history, marks the latest person killed by the contagious, incurable disease that has devastated communities in Guinea, Liberia and Sierra Leone since February. At last official count, released July 23, 672 people have died from the virus.
Outbreaks like this one beg for a vaccine, especially given the fatality rate of the disease, which can be up to 90 percent, according to the World Health Organization. The virus has popped up sporadically since 1976, when the Zaire species of Ebola virus was first recognized in Africa.
According to a Scientific American Q and A of leading virologist Thomas Geisbert, progress on a vaccine is stalled. But he says there are three to five preventative vaccines that have proven to protect nonhuman primates against the fatal virus.
The University of Texas researcher says scientists are stuck in phase I trials in humans. He estimates we are anywhere from two to six years from being able to break ground on an effective vaccine:
''I hate to say this, but it really depends on financial support for the small companies that develop these vaccines. Human studies are expensive and require a lot of government dollars. With Ebola, there's a small global market '-- there's not a big incentive for a large pharmaceutical company to make an Ebola vaccine, so it's going to require government funding.
In terms of potential, he gives the example of the VSV vaccine, which functions similarly to the rabies vaccine. But Geisbert explains that vaccines like this one require a booster. The catch in Africa, he notes, is that ''you're lucky to get someone into a clinic to be vaccinated once. It's a trade-off '-- efficacy versus safety. That's one of the biggest challenges.''
As shown by the CDC map above, Ebola treatment centers, laboratories and clinics are not necessarily easily accessible by all communities.
Tekmira's Ebola Drug Trial Placed on Hold by U.S. FDA
Human tests of Tekmira Pharmaceuticals Corp. (TKMR)'s treatment for Ebola, one of the world's most lethal diseases, have been put on hold by U.S. regulators due to safety concerns.
The Food and Drug Administration has requested additional information to ensure the drug is safe at higher doses, the company said today in a statement. The therapy is in the first of three stages of clinical trials usually required by regulators for approval.
Tekmira will ''continue our dialogue with the FDA, provided for under our fast-track status, in order to advance the development of this important therapeutic agent,'' Tekmira's Chief Executive Officer Mark Murray said in the statement. The company didn't say how long the hold was expected to last, and spokeswoman Julie Rezler didn't immediately respond to a phone call requesting comment.
Shares of the Vancouver-based drugmaker fell 16 percent to $11.63 at the close in New York, the biggest single-day decline since April 14.
The Ebola virus kills as many as 90 percent of those it strikes, and the latest outbreak in Guinea, Liberia and Sierra Leone is the worst on record, resulting in more than 450 deaths. The World Health Organization has said the outbreak may last another three to four months.
Despite the deadly nature of the disease, the relative rarity of outbreaks and their confinement to primarily rural areas of poor African nations make Ebola an unattractive target for big drugmakers.
Instead, much of the research in Ebola treatments has been funded by the U.S. government. Tekmira said its drug, an RNA-based therapy, is being developed under a $140 million contract with the U.S. Department of Defense.
Among the most promising experimental drugs are antibody cocktails. One is being developed at Canada's National Microbiology Laboratory, though it needs more work before it can be tested in humans, according to Public Health Canada.
Mapp Biopharmaceutical Inc., a closely held company in San Diego, is developing another, along with the U.S. Defense Advanced Research Projects Agency, the National Institutes of Health and the U.S. Defense Threat Reduction Agency.
To contact the reporters on this story: Caroline Chen in New York at cchen509@bloomberg.net; Makiko Kitamura in London at mkitamura1@bloomberg.net
To contact the editors responsible for this story: Reg Gale at rgale5@bloomberg.net Andrew Pollack, Angela Zimm
U.S. government seeking to test Ebola vaccine on humans: reports | Reuters
LOS ANGELES (Reuters) - The U.S. government will begin testing on people an experimental Ebola vaccine as early as September, after seeing positive results from tests on primates, according to media reports on Thursday.
The National Institutes of Health's infectious disease unit is working with the U.S. Food and Drug Administration to put the vaccine into trial as quickly as possible, according to CNN and USA Today. The director of that unit could not be reached for comment.
'Fast-track the Ebola drug': U.S. under pressure to give potentially life-saving medication the green light as experts warn of global pandemic
A petition has been launched urging the U.S. Food and Drug Administration to fast-track a new Ebola drugThere is currently no cure or vaccine for the deadly diseaseBut a clinical trial for potentially the first drug was put on hold this month672 people have died as the disease sweeps through Western AfricaHead of global charity calls for experimental drugs to be offered to victimsExpert says virus is 'as infectious as flu' and poses global pandemic threatBut specialist said if the disease reaches UK shores the NHS is preparedBy Lizzie Parry
Published: 09:58 EST, 30 July 2014 | Updated: 06:40 EST, 31 July 2014
855shares
123
Viewcomments
Health campaigners are today calling for U.S. authorities to speed up their approval of a new drug hoped to be the first cure for the deadly Ebola virus.
There is currently no cure or vaccine for the disease, which has claimed the lives of 672 people in West Africa, since February.
The head of global charity The Wellcome Trust earlier this month called for experimental drugs to be offered to those diagnosed with the virulent illness in West Africa.
Despite the drugs not being fully tested Jeremy Farrar, professor of tropical medicine and director of the trust, said Ebola's spread in Guinea, Liberia and Sierra Leone is 'out of control'.
Scroll down for videos
Nigerian health officials are in the process of trying to trace 30,000 people, believed to be at risk of contracting the highly-infectious virus, following the death of Patrick Sawyer in Lagos
The latest outbreak of Ebola is the most severe since the disease was discovered in 1976. So far the disease has spread from a village in Guinea to Sierra Leone, Liberia and Nigeria
Health campaigners have petitioned U.S. authorities, calling for the Food and Drug Administration to fast-track their approval of a new Ebola drug, which could be the first cure for the disease
He urged global health authorities to re-think the guidelines on potential treatments.
The latest outbreak, the most severe since the Ebola virus was discovered in 1976, has spread from a small village in Guinea to neighbouring Sierra Leone and Liberia.
But it was the death of a U.S. citizen, Patrick Sawyer, in the Nigerian capital of Lagos on Friday that prompted fears the disease could spread to the Western world.
The 40-year-old died at a Lagos hospital having been isolated there after collapsing at the city's airport when he fell ill returning from his sister's funeral in Liberia after she too succumbed to the disease.
FDA CAN ASSESS EMERGENCY USE ON CASE-BY-CASE BASISA spokeswoman for the FDA said there are guidelines under which they can authorise the emergency use of a medical product, not yet approved via the formal channels.
She said: 'The FDA may allow the emergency use of drugs under an investigational new drug application using expanded access or, in some circumstances, an emergency use authorisation.'
She said the decision is made on a case-by-case basis, 'taking into account the anticipated or actual emergency, size of the affected population, and risk-benefit analysis'.
'The FDA is working with U.S. government agencies who fund medical product development and product sponsors to facilitate the development of and access to medical products that could potentially be used to mitigate the Ebola outbreak in West Africa.
'The FDA granted Fast Track Designation to an investigational anti-Ebola therapeutic being developed with support from the U.S. Department of Defense in March 2014.
'Fast track is a process designed to facilitate the development and expedite the review of drugs to treat serious conditions and fill an unmet medical need.
Once a drug receives Fast Track designation, early and frequent communication between the FDA and a drug company is encouraged throughout the entire drug development and review process.
The frequency of communication assures that questions and issues are resolved quickly, often leading to earlier drug approval and access by patients.'
She added: 'While the FDA cannot comment on the development of specific medical products, it's important to note that every FDA regulatory decision is based on a risk-benefit assessment that includes the context of use for the product and the patient population being studied.
'Therefore, a clinical hold for a certain population does not mean a clinical hold for all populations. If the benefits of studying the product on a human subject outweigh risk, we may consider permitting that study to proceed.
Mr Sawyer's death has prompted Nigerian health officials to begin the process of trying to trace 30,000 people, believed to have come into contact with the consultant for Liberia's Finance Ministry, who was en route home to Minnesota.
Dr Derek Gatherer of the University of Lancaster has warned of a global pandemic, claiming the virus is as infectious as flu.
He warned each person infected with the disease could spread the virus to at least two other people.
But Professor Robert Dingwall from Nottingham Trent University, told MailOnline while the disease has the potential to become an epidemic in regions that are overcrowded with limited health services, the UK is well placed to face the virus if it reaches British shores.
Campaigners are calling on the Food and Drug Administration (FDA) of the United States to fast-track their authorisation of the TKM-Ebola drug.
The petition, created on change.org, states: 'One of the most promising is TKM-Ebola manufactured by Tekmira Pharmaceuticals.
'This drug has been shown to be highly effective in killing the virus in primates and Phase 1 clinical trials to assess its safety in humans were started earlier this year.'
In July the FDA put clinical trials on hold over concerns about the dose being given to volunteers, despite the fact 14 research participants had already safely tolerated the drug, campaigners said.
Those responsible for the petition added: 'Given that at least one patient has transferred the disease from Liberia to Nigeria by air travel, the possibility of a global pandemic becomes increasingly likely.
'In view of this it's imperative that the development of these drugs be fast-tracked by the FDA and the first step should be releasing the hold on TKM-Ebola.
'There is a precedent for fast tracking anti-Ebola drugs in emergency cases as happened last year when a researcher was exposed to the virus and received an experimental vaccine.'
Professor Farrar said the normal drug development process - of years of testing new drugs in animals, then in healthy human volunteers before they go to clinical trials in sick patients before being approved by regulators - takes too long and should not apply in rapidly spreading outbreaks of diseases like Ebola.
Speaking at a time when 450 people had already lost their lives, he said: 'Not a single individual has been offered anything beyond tepid sponging and "we'll bury you nicely".
'It's just unacceptable.'
Professor Farrar pointed to several experimental drugs and vaccines in development as potential treatments or preventative measures against Ebola, and questioned why they were not being tested in a situation where people at high risk might benefit.
'It's ridiculous that we haven't got these (experimental) products out of labs and animal trials and into human testing, and at least offered to people,' he said.
EBOLA CURE IS HAMPERED BY FUNDING, EXPERTS SAYAt least four vaccines are in development to protect people against Ebola.
But while one of the most promising, a potential first cure for the illness, may be hampered because of funding.
Despite the disease rampaging through West Africa, there is not a huge potential market for a large pharmaceutical compnay to capitalise on.
It means the U.S. government is left to deal with smaller, niche biopharmaceutical companies.
'I don't see why anybody except the U.S. government would get involved in developing these kinds of countermeasures,'Dr. Sina Bavari of the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID) in Frederick, Maryland told NBC. 'There is no market in it.'
Dr Thomas Geisbert, whose lab at the University of Texas Medical Branch is working on some of the drugs, added: 'There are at least four vaccines that can protect against Ebola (in monkeys).
'But how do you take this to the next level?'
U.S. citizen Patrick Sawyer, pictured with his daughter Ava, died on Friday in the Nigerian capital of Lagos having become infected with the Ebola virus. His death prompted fears of a global pandemic after he flew from Liberia to Nigeria
Ebola (above) has already killed 672 people in Guinea, Liberia, Sierra Leone and Nigeria and infected more than 1,200 since it was first diagnosed in February. Symptoms include sudden fever, vomiting and headaches
A number of patients have been discharged from Ebola treatment centres in Guinea after successfully beating the Ebola virus, says M(C)decins Sans Fronti¨res
WHAT HAPPENS WHEN YOU CATCH THE DEADLY EBOLA VIRUS?A person infected with Ebola won't realise the deadly disease is lurking in their body for up to three weeks.
When it hits, the onset is sudden and harsh.
A fever, crippling headaches and muscle aches are the first sign something is wrong.
But the fact the virus mimics the symptoms of a common cold means it is difficult to spot.
Within a few days, the virus causes a condition known as disseminated intravascular coagulation. It causes blood clots and hemorrhaging.
In Ebola victims the clots affect the liver, spleen, brain and other internal organs, forcing capillaries to bleed into the surrounding tissue.
Nasuea, vomiting and diarrheoa with blood and mucus, conjunctivitis and a sore throat follow.
A rash is then likely to appear on the torso, spreading quickly to the limbs and head.
The patient will then endure spontaneous bleeding from their ears, eyes, mouth and other orifices as well as any breaks in the skin.
Internally they will suffer bleeding in the gastrointestinal tract and internal organs, as the virus pierces veins and blood vessels.
Death is usually brought on by hemorrhaging, shock or renal failure and typically occurs between eight and 17 days after a person first falls ill.
'If you had a 60 per cent chance of dying tomorrow, and there was something that had been tested in healthy volunteers (but not yet tried in patients or approved), would you take it?'
The pipeline of drugs being developed for Ebola is far from bulging - partly due to a lack of research money for a medicine which is likely to be needed mainly in poor countries with scant healthcare funds.
But several small biotech companies and U.S. university departments are developing potential vaccines.
Tekmira Pharmaceuticals, which teamed up with the U.S. Department of Defense on an injectable drug for Ebola, started their initial Phase I trial in healthy volunteers in January.
U.S.-based Inovio and privately held Vaxart are among those with experimental vaccines in animal testing, while GlaxoSmithKline last year acquired Swiss vaccine firm Okairos with an early-stage Ebola product.
Professor Farrar noted that while Ebola is a relatively rare disease, outbreaks have come regularly since the virus was first identified some 40 years ago, and can be predicted to happen in future - making testing potential drugs a sensible approach.
'This is not the first time this has happened, and it will happen again - we know that,' he said.
'And we could all have pushed for having stockpiles (of experimental drugs) maybe held in Geneva, and they could have had WHO ethical approval, and then we'd be ready to go (when the next outbreak comes).'
Medical personnel at the Doctors Without Borders facility in Kailahun, Sierra Leone, where leading Ebola doctor Sheik Humarr Khan died
Philip Hammond says the Government is responding to Ebola threat
Dr Gatherer, a specialist in the evolution of viruses, said the panic sparked by the death of Mr Sawyer in Lagos, is justified.
'Anyone on the same plane could have become infected because Ebola is easy to catch,' he said.
'It can be passed on through vomiting, diarrhoea or even from simply saliva or sweat - as well as being sexually transmitted.
'That is why there is such alarm over Mr Sawyer because he became ill on the flight so anyone else sharing the plane could have been infected by his vomit or other bodily fluids.'
He said: 'Only about 10 per cent recover. The outlook is pretty bleak. They will need to trace everyone on the passenger list and isolate them as a precaution.
'I believe they have contacted about half so far but the others could be anywhere else in the world now.
'There is no treatment - nothing you can do yourself. It's in the lap of the gods if you're lucky to be one of the few who survive.
'If it's spotted in the early stages you can be given oral rehydration in hospital to replenish the liquid the body is losing because of the diarrhoea - or be put on an intravenous drip if the vomiting means you can't keep a pill down.
'You may get a painkiller for the headaches and opiates to calm the nerves.
'In the early stages Ebola attacks the same immune system cells as Aids. People who resist this early onslaught are more likely to survive.
'In the case of a pandemic it means doctors could test people early so they can concentrate on those patients rather than ones whose cells are shot.'
Virus: Symptoms of Ebola include high fever, bleeding, damage to the nervous system and vomiting
Outbreak: There is no vaccine or cure for Ebola, which is spread by contact with infected blood or bodily fluids
Dr Gatherer said research into experimental vaccines have been going on for decades and one could be available in the next 'three to five years'.
Dr Gatherer said: 'This infection rate is the same as flu. So it's not as virulent as measles for instance which has an infection rate of 15 with any outbreak causing a slew of cases.
'To stop Ebola's spread hygiene is vital but in Africa it's impossible to get people washing their hands five times a day in places where there's not even running water.
'The World Health Organisation and other agencies could suffocate outbreaks fairly easily when they were contained in rural villages but West Africa is so urbanised in comparison it's much more difficult to contain and we're now out of our comfort zone.'
He said public alarm was justified because the current outbreak is the biggest the world has ever seen.
'The previous record was 400 cases at the turn of the Millennium. Now we have had 1,200 - already three times that number - and the first in a big city,' he said.
'It's an emerging disease that only appeared in the 70s. There were no records of it during the colonial period of the 50s and 60s and there would have been because it's such a horrible death.
'In the latter stages you get a haemmorhagic fever with blood blisters bursting from your nose and mouth. Aids spread from Central Africa to the western world in the 1980s - Ebola could do the same.'
Hong Kong prepares for possible Ebola outbreak
Spreading: The outbreak has hit Guinea, Sierra Leone, Liberia and has now killed a man in far more densely populated Nigeria. The outbreak is the deadliest ever of the terrifying disease as the death toll crept past 670
But Dr Gatherer said: 'We kept rabies out for a long time. There was no rabies in Britain while they were having it in Spain and France because we jumped on it and isolated it.
'I'm confident Public Health England has the resources to do the same with Ebola.'
Professor Robert Dingwall, a specialist in health policy responses to infectious diseases at Nottingham Trent University, echoed Dr Gatherer's confidence in the NHS.
He told MailOnline: 'In a region where many people live in overcrowded conditions with poor communications and limited health services, there is a real risk of the outbreak becoming an epidemic.
'The UK government is taking the threat seriously, but the virus would arrive into a very different environment.
'There is no animal species that carries the infection when it is not active in people '' while there is some smuggling of 'bushmeat', which could carry the virus, this is not a large-scale problem.
'Although recent NHS reforms have disrupted the public health infrastructure that successfully managed the 2009 influenza pandemic, we could still mount a well-organised response.
'However, we cannot hope to keep cases out at the borders.
'The interval between the time someone is infected and the time symptoms appear varies from two to 21 days and people who survive can continue to pass on the virus for up to seven weeks.
'When the symptoms first appear, they are hard to distinguish from many more common feverish infections.
'The important thing is for both doctors and patients to be vigilant, if someone develops a fever and has either been in West Africa or passed through a hub airport with a lot of West African traffic.
'We are not doomed in the UK, but it is sensible to raise our level of alert.'
MailOnline has contacted the FDA for comment and is awaiting their response.
Watch an interview with a survivor of the deadly ebola virus
ARE YOU AT RISK OF CATCHING THE INCURABLE, DEADLY EBOLA VIRUS?What is Ebola virus disease?
Ebola is a severe, often fatal illness, with a death rate of up to 90 per cent.The illness affects humans as well as primates, including monkeys, gorillas and chimpanzees.
How do people become infected with the virus?
Ebola is transmitted through close contact with the blood, secretions, organs or other bodily fluids of infected animals.
In Africa infection in humans has happened as a result of contact with chimpanzees, gorillas, fruit bats, monkeys, forest antelope and porcupines found ill or dead in the rainforest.
Once a person becomes infected, the virus can spread through contact with a sufferer's blood, urine, saliva, stools and semen. A person can also become infected if broken skin comes into contact with a victim's soiled clothing, bed linen or used needles.
Men who have recovered from the disease, can still spread the virus to their partner through their semen for seven weeks after recovery. The Ebola virus is fatal in 90 per cent of cases and there is no vaccine and no known cure.
Ebola is a severe, often fatal illness, with a death rate of up to 90 per cent
Who is most at risk?
Those at risk during an outbreak include:
health workersfamily members or others in close contact with infected peoplemourners with direct contact with the bodies of deceased victimshunters in contact with dead animalsWhat are the typical signs and symptoms?
Sudden onset of fever, intense weakness, muscle pain, headache and sore throat. That is followed by vomiting, diarrhoea, rash, impaired kidney and liver function and internal and external bleeding.
The incubation period is between two and 21 days. A person will become contagious once they start to show symptoms.
When should you seek medical care?
If a person is in an area affected by the outbreak, or has been in contact with a person known or suspected to have Ebola, they should seek medical help immediately.
What is the treatment?
Severely ill patients require intensive supportive care. They need intravenous fluids to rehydrate them.
But there is currently no specific treatment for the disease. Some patients will recover with the appropriate care.
Can Ebola be prevented?
Currently there is no licensed vaccine for Ebola. Several are being tested but are not available for clinical use.
Is it safe to travel to affected areas?
The World Health Organisation reviews the public health situation regularly, and recommends travel or trade restrictions if necessary. The risk of infection for travellers is very low since person-to-person transmission results from direct contact with bodily fluids of victims.
Published time: July 30, 2014 13:11Edited time: July 30, 2014 15:22A scientist separates blood cells from plasma cells to isolate any Ebola RNA (Reuters / Misha Hussain)
A German hospital has agreed to treat Ebola patients amid widespread fears of a possible outbreak of the deadly disease in Europe. Over 670 people have already been killed by the disease in West Africa with doctors struggling to control the epidemic.
A German hospital in Hamburg agreed to accept patients following a request from the World Health Organization (WHO), Deutsche Welle reports. Doctors assure that the utmost precautions will be taken to make sure the disease does not spread during treatment. The patients will be kept in an isolation ward behind several airlocks, and doctors and nurses will wear body suits with their own oxygen supplies that will be burned every three hours.
German authorities were expecting the arrival of Sheik Umar Khan, an Ebola expert who caught the disease while treating patients in Sierra Leone, but he died before he could be transported.
"We were actually anticipating the patient's arrival over the weekend," Dr. Jonas Schmidt-Chanasit, head of the viral diagnostic unit at Hamburg's Bernhard-Nocht-Institute, told German public broadcaster NDR.
This latest outbreak of Ebola originated in Guinea in February and quickly spread to Liberia, Sierra Leone and Nigeria where the first case was reported last week. The disease has already claimed over 650 lives and has prompted authorities in Europe to take measures to prevent its spread.
British Foreign Secretary Philip Hammond will chair a meeting of the Cabinet Office Briefing Room (COBRA) on Wednesday to discuss the government's reaction to the outbreak of the deadly disease. On Monday, a man was tested for the virus at a Birmingham Airport following a flight from Nigeria via Paris. The Department of Health later confirmed that the tests were negative and said the UK authorities were prepared to deal with the threat of Ebola.
''Protecting the public from infectious diseases is a priority and we lead the world in this field. We are well prepared to identify and deal with any potential cases of Ebola,'' a Department of Health official told reporters.
In Hong Kong, a woman has been hospitalized with a suspected case of Ebola. According to reports from China Daily, the woman had recently returned home from a trip to Africa.
In an effort to confine the spread of the disease, the International Civil Aviation Organization will consult with the World Health Organization.
"Until now [the virus] had not impacted commercial aviation, but now we're affected," WHO Secretary-General Raymond Benjamin told the media, referencing the death of a 40-year-old man who died of Ebola after traveling on Togo-based airline ASKY from Liberia to Nigeria via the Togolese capital of Lome.
"We will have to act quickly," Benjamin said. "We will consult with the WHO to see what types of measures should be put in place."
The Ebola virus spreads through direct contact of bodily fluids and is deadly in up to 90 percent of cases. Symptoms include fever, vomiting and internal bleeding.
Most border crossings in Liberia, located in West Africa, have been closed and communities hit by an Ebola outbreak face quarantine to try to halt the spread of the virus. The symptoms include high fever, bleeding and central nervous system damage. Fatality rates can reach 90% and the incubation period is two to 21 days. THERE IS NO VACCINE OR CURE (CDC).
How It All BeginsUnited States aid worker, Nancy Writebol, a missionary sent by the Calvary Church in North Carolina, became the second American citizen to contract the Ebola. Previously, Dr Kent Brantly, a doctor also working at an Ebola clinic in the capital of Liberia, Monrovia, had previously been infected with the deadly Ebola virus while treating victims of the disease at a hospital in West Africa. Ebola is transmitted through bodily fluids, stated Tarik Jasarevic, a spokesman for the WHO, said around 100 health workers had been infected by Ebola in three countries. The virus has now killed 660 people across Guinea, Liberia and Sierra Leone since the outbreak began nearly six months ago. Ebola has a mortality of approximately 90% and overwhelms the health care systems of the communities in which it appears.
ContainmentThe past week has seen Ebola infecting key medical staff in Sierra Leone, a deadly Middle East virus has become airborne and a whole city in China put on lock-down for fear of bubonic plague. Lockdown? What exactly is lockdown? If a community is to stop Ebola, they must go into lockdown procedures. Lockdown procedures include the closing of the border to a present non-infected nation. The map, below, shows the impacted countries experiencing an Ebola outbreak.
Why are we admitting people to the U.S. who are coming from a region with a live Ebola outbreak. Presently, Ebola is not being tested for at the U.S. Border.
Both Dr. Jane Orient, one of Arizona's top physicians as well as other researchers, such as myself, have received information, from Border Patrol informants, that as many as 100,000 West Africans are being admitted to the United States under the same provisions that President Obama is presently admitting so-called ''unaccompanied minors''. These people are from the same region of the world as the uncontained outbreak of Ebola. As Dr. Orient said in her interview on The Common Sense Show, on June 30, 2014, ''It is not a matter of if Ebola comes into the United States, but when.''
The United States Containment ProceduresFortunately, the United States has detailed procedures to deal with a pandemic outbreak and it carries the force of law. Under section 361 of the Public Health Service Act (42 U.S. Code § 264), the U.S. Secretary of Health and Human Services is authorized to take measures to prevent the entry and spread of communicable diseases from foreign countries into the United States and between states. The authority for carrying out these functions on a daily basis has been delegated to the Centers for Disease Control and Prevention (CDC). The CDC utilizes two basic strategies when trying to contain a public outbreak of something as deadly as Ebola and they are Isolation and Quarantine.
''Isolation is used to separate ill persons who have a communicable disease from those who are healthy. Isolation restricts the movement of ill persons to help stop the spread of certain diseases. For example, hospitals use isolation for patients with infectious tuberculosis.Quarantine is used to separate and restrict the movement of well persons who may have been exposed to a communicable disease to see if they become ill. These people may have been exposed to a disease and do not know it, or they may have the disease but do not show symptoms. Quarantine can also help limit the spread of communicable disease'' (CDC). Quarantining involves the creation of detainment facilities in which people, who are suspected, or are infected with a pathogen, are forcibly detained and not allowed to leave. This statute also applies, in the same manner, as people who ''may be exposed''.
The United States Is Moving to Establish Quarantine CentersEven if there was not a present immigration crisis at the border, there is a significant outbreak of Ebola in a seven country region of West Africa. With modern air travel, this government should be enacting protocols to limit the chances for Ebola from coming into the United States. Instead, President Obama is having ICE and DHS load up the busses and planes, at taxpayers expense to ship them throughout the United States without going through a minimum of a three week health screening period (i.e. Ebola's incubation period). This is highly irresponsible and could be considered to be an act of treason being committed against the people of the United States. Under federally mandated quarantine procedures, here is what the CDC and President Obama are mandated to do in the present crisis. Here is what is supposed to happen as described by the CDC:
The Secretary of the Department of Health and Human Services has statutory responsibility for preventing the introduction, transmission, and spread of communicable diseases in the United States. Under its delegated authority, the Division of Global Migration and Quarantine works to fulfill this responsibility through a variety of activities, including
the operation of Quarantine Stations at ports of entry
establishment of standards for medical examination of persons destined for the United States, and
administration of interstate and foreign quarantine regulations, which govern the international and interstate movement of persons, animals, and cargo.
Instead, we are getting this type of Obama led method of pandemic protection, as described below.
Ebola Quarantine CentersYesterday, Paul Watson opened a lot of eyes with the following statement: '' The source, an office clerk within the LADHS, said that during a policy meeting on the morning of June 18th last month, his supervisor announced that the Los Angeles County Dept. of Health Services had struck a deal with the government to open up ''low cost housing'' facilities for homeless people, otherwise known as ''FEMA camps.'' The source said that his supervisor ordered staff not to use the term ''FEMA camps.'' One look at who is behind this program should raise the eyebrows of every person. as it is being administered by the Department of Health Services.
''In an effort to respond to the high need for recuperative care services, Housing for Health will open a 38 bed recuperative care site in South LA this summer. The goal of recuperative care is to provide short-term housing with health oversight to homeless DHS patients who are recovering from an acute illness or injury or have conditions that would be exacerbated by living on the street or in shelters. The site was renovated to serve patients with mobility impairments and provides wheelchair accessible community space indoors and in an open-air courtyard. The site will be operated by LAMP Community, a non-profit agency with over 25 years of experience providing services to homeless individuals''.
ConclusionAt a time when city, state and federal budgets are stretched to infinity, we are supposed to believe that out of the goodness of their hearts, LA County is going to provide these kinds of services at this kind of expense to previously ignored homeless people? Does any of this make any sense given the economic state of the country? Paul Watson is calling these facilities, FEMA camps. I agree with Paul and would also add that they are FEMA Quarantine Camps. This is the early preparation for what is coming. Cities across the country, from Tempe, AZ. to Charleston, SC., are outlawing homeless people as it gives the government to quarantine these people. A clear pattern is emerging that we are soon going to see from California to South Carolina homeless people being quarantined, held against their will, for ''health'' reasons. The handling of the present and potential Ebola crisis speaks for itself. When there is trouble America, who are you going to call? Thirty years ago, we called the Ghostbusters (i.e. hit movie 1984), which is a whole lot better than what is available now.
HUMAN EBOLA VIRUS SPECIES AND COMPOSITIONS AND METHODS THEREOF
DEPOSIT STATEMENT[0001] The invention provides the isolated human Ebola (hEbola) viruses denoted as Bundibugyo (EboBun) deposited with the Centers for Disease Control and Prevention ("CDC";Atlanta, Georgia, United States of America) on November 26, 2007 and accorded an accession number 200706291. This deposit was not made to an International Depository Authority (IDA) as established under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure, and is a non-Budapest treaty deposit. The deposited organism is not acceptable by American Type Culture Collection (ATCC), Manassas, Virginia, an International Depository Authority (IDA) as established under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. Samples of the stated Deposit Accession No. 200706291 will be made available to approved facilities for thirty years from the date of deposit, and for the lifetime of the patent issuing from, or claiming priority to this application.
RELATED APPLICATIONS
[0002] This application claims priority benefit of U.S. Provisional Application 61/108,175 filed 24 October 2008; the contents of which are hereby incorporated by reference.
FIELD OF THE INVENTION
[0003] The invention is related to compositions and methods directed to a novel species of human Ebola (hEbola) virus.
BACKGROUND OF THE INVENTION
[0004] The family Filoviridae consists of two genera, Marburgvirus and Ebolavirus, which have likely evolved from a common ancestor'. The genus Ebolavirus includes four species: Zaire, Sudan, Reston and Cote d'Ivoire (Ivory Coast) ebolaviruses, which have, with the exception of Reston and Cote d'Ivoire ebolaviruses, been associated with large hemorrhagic fever (HF) outbreaks in Africa with high case fatality (53-90%)2.
[0005] Viruses of each species have genomes that are at least 30-40% divergent from one another, a level of diversity that presumably reflects differences in the ecologic niche they occupy and in their evolutionary history. Identification of the natural reservoir of ebolaviruses remains somewhat elusive, although recent PCR and antibody data suggest that three species of arboreal fruit bats may be carriers of Zaire ebolavirus3. No data has yet been published to suggest reservoirs for the Sudan, Reston and Cote d'Ivoire ebolavirus species. However, a cave-dwelling fruit bat has been recently implicated as a natural host for marburgvirus4' s, supporting the hypothesis that different bat species may be the reservoir hosts for the various filoviruses.
[0006] Filovirus outbreaks are sporadic, sometimes interspersed by years or even decades of no apparent disease activity. The last new species of ebolavirus was discovered 14 years ago (1994), in Cote d'Ivoire (Ivory Coast), and involved a single non-fatal case, a veterinarian who performed an autopsy on an infected chimpanzee found in the Tai Forest6. No further disease reports have been associated with Cote d'Ivoire ebolavirus, in contrast to Zaire and Sudan ebolaviruses which have each caused multiple large outbreaks over the same time period.
[0007] In late November 2007, HF cases were reported in the townships of Bundibugyo and Kikyo in Bundibugyo District, Western Uganda. The outbreak continued through January 2008, and resulted in approximately 149 cases and 37 deaths. Laboratory investigation of the initial 29 suspect-case blood specimens by classic methods (antigen capture, IgM and IgGELISA) and a recently developed random-primed pyrosequencing approach identified this to be an Ebola HFoutbreak associated with a new discovered ebolavirus species. These specimens were negative when initially tested with highly sensitive real-time RT-PCR assays specific for all known Zaire and Sudan ebolaviruses and Marburg viruses. This new species is referred to herein as "the Bundibugyo species", abbreviated "EboBun".
[0008] Accordingly, compositions and methods directed to the new Ebola virus species are described herein and the most closely related Ebola Ivory Coast species, which compositions and methods are useful for diagnosis and prevention of human Ebola virus infection; including related vaccine development, and prevention of hemorrhagic fever in a human population.
SUMMARY OF THE INVENTION
[0009] The present invention is based upon the isolation and identification of a new human Ebola virus species, EboBun. EboBun was isolated from the patients suffering from hemorrhagic fever in a recent outbreak in Uganda. The isolated virus is a member of the Filoviridae family, a family of negative sense RNA viruses. Accordingly, the invention relates to the isolated EboBun virus that morphologically and phylogenetically relates to known members filoviridae.
[0010] In one aspect, the invention provides the isolated EboBun virus deposited with the Centers for Disease Control and Prevention ("CDC"; Atlanta, Georgia, United States of America) on November 26, 2007 and accorded an accession number 200706291, as stated in the paragraph entitled "DEPOSIT STATEMENT" supra.
[0011] In another aspect, the invention provides an isolated hEbola EboBun virus comprising a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: a) a nucleotide sequence set forth in SEQ ID NO: 1; b) a nucleotide sequence that hybridizes to the sequence set forth in SEQ ID NO: 1 under stringent conditions; and c) a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the SEQ ID NO:1. In another aspect, the invention provides the complete genomic sequence of the hEbola virus EboBun.
[0012] In a related aspect, the invention provides nucleic acid molecules isolated from EboBun, or fragments thereof.
[0013] In another aspect, the invention provides proteins or polypeptides that are isolated from the EboBun, including viral proteins isolated from cells infected with the virus but not present in comparable uninfected cells; or fragments thereof. In one embodiment of the present invention, the amino acid sequences of the proteins or polypeptides are set forth in SEQ IDNOS: 2-9 and 59, or fragments thereof.
[0014] In a related aspect, the invention provides an isolated polypeptide encoded by the nucleic acid molecule of the inventive hEbola EboIC (Sequence ID No. 10) virus described above.
[0015] In another aspect, the invention provides an isolated hEbola EboICvirus comprising a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: a) a nucleotide sequence set forth in SEQ ID NO: 10; b) a nucleotide sequence that hybridizes to the sequence set forth in SEQ ID NO: 10 under stringent conditions; and c) a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the SEQ ID NO:10. In another aspect, the invention provides the complete genomic sequence of the hEbola virus EboIC.
[0016] In a related aspect, the invention provides nucleic acid molecules isolated from EboIC, or fragments thereof.
[0017] In another aspect, the invention provides proteins or polypeptides that are isolated from the EboIC, including viral proteins isolated from cells infected with the virus but not present in comparable uninfected cells; or fragments thereof. In one embodiment of the present invention, the amino acid sequences of the proteins or polypeptides are set forth in SEQ IDNOs: 11-19, or fragments thereof.
[0018] In a related aspect, the invention provides an isolated polypeptide encoded by the nucleic acid molecule of the inventive hEbola EboIC virus described above.
[0019] In other aspects, the invention relates to the use of the isolated hEbola virus for diagnostic and therapeutic methods based on EbBun, EboIC, or a combination thereof. In one embodiment, the invention provides a method of detecting in a biological sample an antibody immunospecific for the genus of West Afrin Ebola Species constituting hEbola EbBun and EboICvirus using at least one the inventive isolated hEbola virus described herein, or any of the inventive proteins or polypeptides as described herein. In another specific embodiment, the invention provides a method of screening for an antibody which immunospecifically binds and neutralizes hEbola EboBun. Such an antibody is useful for a passive immunization or immunotherapy of a subject infected with hEbola.
[0020] In another aspect, the invention provides an isolated antibody or an antigen-binding fragment thereof which immunospecifically binds to the hEbola virus of the invention described above.
[0021] In other aspects, the invention provides methods for detecting the presence, activity or expression of the Glade of Bundibungyo-Ivory Coast hEbola virus in a biological material, such as cells, blood, saliva, urine, feces and so forth; and specifically at least one of EbBun or EboIC.
[0022] In a related aspect, the invention provides a method for detecting the presence of the inventive hEbola virus described above in a biological sample, the method includes (a) contacting the sample with an agent that selectively binds to a West African hEbola virus; and (b) detecting whether the compound binds to the West African hEbola virus in the sample.
[0023] In another aspect, the invention provides a method for detecting the presence of the inventive polypeptide described above, in a biological sample, said method includes (a) contacting the biological sample with an agent that selectively binds to the polypeptide;and (b) detecting whether the agent binds to the polypeptide in the sample. In another aspect, the invention provides a method for detecting the presence of a first nucleic acid molecule derived from the inventive hEbola virus described above in a biological sample, the method comprising: (a) contacting the biological sample with an agent that selectively binds to the polypeptide; and (b) detecting whether the agent binds to the polypeptide in the sample.
[0024] In another aspect, the invention provides a method for propagating the hEbola virus in host cells comprising infecting the host cells with the inventive isolated hEbola virus described above, culturing the host cells to allow the virus to multiply, and harvesting the resulting virions.Also provided by the present invention are host cells infected with the inventive hEbola virus 5 described above.
[0025] In another aspect, the invention provides a method of detecting in a biological sample the presence of an antibody that immunospecifically binds hEbola virus, the method comprising: (a) contacting the biological sample with the inventive host cell host described above; and (b) detecting the antibody bound to the cell.
[0026] In another aspect, the invention provides vaccine preparations, comprising the inventive hEbola virus, including recombinant and chimeric forms of the virus, nucleic acid molecules comprised by the virus, or protein subunits of the virus. The invention also provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier. In one embodiment, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the inventive hEbola virus described above, or a subunit thereof; and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of inventive the nucleotide sequences as described above, or a complement thereof, and a pharmaceutically acceptable carrier.
[0027] In a related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a protein extract of the inventive hEbola virus described above or a subunit thereof, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the inventive nucleotide sequence as described above or a complement thereof, and a pharmaceutically acceptable carrier. In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of any of the inventive polypeptides described above.
[0028] In another aspect, the present invention provides pharmaceutical compositions comprising antiviral agents of the present invention and a pharmaceutically acceptable carrier. In a specific embodiment, the antiviral agent of the invention is an antibody that immunospecifically binds hEbola virus or any hEbola epitope. In another specific embodiment, the antiviral agent is a polypeptide or protein of the present invention or nucleic acid molecule of the invention.
[0029] In a related aspect, the invention provides a pharmaceutical composition comprising a prophylactically or therapeutically effective amount of an anti-hEbola EboBun agent and a pharmaceutically acceptable carrier.
[0030] The invention also provides kits containing compositions and formulations of the present invention. Thus, in another aspect, the invention provides a kit comprising a container containing the inventive immunogenic formulation described above. In another aspect, the invention provides a kit comprising a container containing the inventive vaccine formulation described above. In another, the invention provides a kit comprising a container containing the inventive pharmaceutical composition described above. In another, the invention provides a kit comprising a container containing the inventive vaccine formulation described above. In another, the invention provides a method for identifying a subject infected with the inventive hEbola virus described above, comprising: (a) obtaining total RNA from a biological sample obtained from the subject; (b) reverse transcribing the total RNA to obtain cDNA; and (c) amplifying the cDNA using a set of primers derived from a nucleotide sequence of the inventive hEbola virus described above.
[0031] The invention further relates to the use of the sequence information of the isolated virus for diagnostic and therapeutic methods.
[0032] In another aspect, the present invention provides methods for screening antiviral agents that inhibit the infectivity or replication of hEbola virus or variants thereof.
[0033] The invention further provides methods of preparing recombinant or chimeric forms of hEbola.
BRIEF DESCRIPTION OF THE DRAWINGS
[0034] FIG. 1 represents a Phylogenetic tree comparing full-length genomes of Ebolavirus and Marburg virus by Bayesian analysis;
[0035] FIG. 2 represents an alignment of genomes of novel hEbola EboBun (SEQID NO: 1) referred to below as "Ebola Bundibugyo" or "EboBun", and hEbola Zaire (SEQ IDNO: 20);referred to below as "Ebola Zaire `76" or "EboZ" and hEbola Ivory Coast (SEQID NO: 10) also referred to below as "EboIC".
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0036] It is to be understood that the present invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
[0037] Due to the sequence divergence of EboBun relative to all previously recognized ebolaviruses, the present invention has utility in design of diagnostic assays to monitor Ebola HFdisease in humans and animals, and develop effective antivirals and vaccines.
[0038] The EboBun virus of the present invention is genetically distinct, differing by more than 30% at the genome level from all other known ebolavirus species. The unique nature of this virus created challenges for traditional filovirus molecular based diagnostic assays and genome sequencing approaches. Instead, over 70% of the virus genome was sequenced using a recently developed random-primed pyrosequencing approach which allowed the rapid development of molecular detection assay which were deployed in the disease outbreak response. This random-primed pyrosequencing draft sequence allowed faster completion of the whole genome sequence using traditional primer walking approach and confirmation that the EboBun virus represented a new ebolavirus species.Definitions [0039] The definitions herein provided are operative throughout the entire description of the invention set forth herein, including the Summary of the Invention.
[0040] The term "an antibody or an antibody fragment that immunospecifically binds a polypeptide of the invention" as used herein refers to an antibody or a fragment thereof that immunospecifically binds to the polypeptide encoded by the nucleotide sequence of SEQ ID NO: 1 (EboBun), or a fragment thereof, and does not non-specifically bind to other polypeptides. An antibody or a fragment thereof that immunospecifically binds to the polypeptide of the invention may cross-react with other antigens. Preferably, an antibody or a fragment thereof that immunospecifically binds to a polypeptide of the invention does not cross-react with other antigens.An antibody or a fragment thereof that immunospecifically binds to the polypeptide of the invention can be identified by, for example, immunoassays or other techniques known to those skilled in the art, or otherwise as described herein.
[0041] An "isolated" or "purified" peptide or protein is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of a polypeptide/protein in which the polypeptide/protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, a polypeptide/protein that is substantially free of cellular material includes preparations of the polypeptide/protein having less than about 30%, 20%, 10%, 5%, 2.5%, or 1% (by dry weight) of contaminating protein. When the polypeptide/protein is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation.When polypeptide/protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly, such preparations of the polypeptide/protein have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than polypeptide/protein fragment of interest.In a preferred embodiment of the present invention, polypeptides/proteins are isolated or purified.
[0042] An "isolated" nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule. Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In a preferred embodiment of the invention, nucleic acid molecules encoding polypeptides/proteins of the invention are isolated or purified. The term "isolated" nucleic acid molecule does not include a nucleic acid that is a member of a library that has not been purified away from other library clones containing other nucleic acid molecules.
[0043] The term "portion" or "fragment" as used herein includes the specified fragment lengths, and all integers in between, inclusive of the specified end points in a specified range, and inclusive of any length up to the full length of a protein, polypeptide, or nucleic acid.
[0044] The term "having a biological activity of the protein" or "having biological activities of the polypeptides of the invention" refers to the characteristics of the polypeptides or proteins having a common biological activity, similar or identical structural domain, and/or having sufficient amino acid identity to the polypeptide encoded by the nucleotide sequence of SEQ IDNO: 1 (EboBun).Such common biological activities of the polypeptides of the invention include antigenicity and immunogenicity.
[0045] The term "under stringent condition" refers to hybridization and washing conditions under which nucleotide sequences having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to each other remain hybridized to each other. Such hybridization conditions are described in, for example but not limited to, Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6.; Basic Methods in Molecular Biology, Elsevier Science Publishing Co., Inc., NY (1986), pp. 75-78, and 84-87; and Molecular Cloning, Cold Spring Harbor Laboratory, NY (1982), pp. 387-389, and are well known to those skilled in the art. A preferred, non-limiting example of stringent hybridization conditions is hybridization in 6 x sodium chloride/sodium citrate (SSC), 0.5% SDS at about 68 C followed by one or more washes in 2 x SSC, 0.5% SDS at room temperature. Another preferred, non-limiting example of stringent hybridization conditions is hybridization in 6 x SSC at about 45 C, followed by one or more washes in 0.2 x SSC, 0.1% SDS at about 50-65 C.
[0046] The term "variant" as used herein refers either to a naturally occurring genetic mutant of hEbola EboBun, or hEbola EboIC, or a recombinantly prepared variation of these hEbola species, each of which contain one or more mutations in its genome compared to the hEbola of SEQ ID NO:1 or 10. The term "variant" may also refer either to a naturally occurring variation of a given peptide or a recombinantly prepared variation of a given peptide or protein in which one or more amino acid residues have been modified by amino acid substitution, addition, or deletion.
[0047] "Homology" refers to sequence similarity or, alternatively, sequence identity, between two or more polynucleotide sequences or two or more polypeptide sequences.
[0048] The terms "percent identity" and "% identity," as applied to polynucleotide sequences, refer to the percentage of identical nucleotide matches between at least two polynucleotide sequences aligned using a standardized algorithm. Such an algorithm may insert, in a standardized and reproducible way, gaps in the sequences being compared in order to optimize alignment between two sequences, and therefore achieve a more meaningful comparison of the two sequences.
[0049] Percent identity between polynucleotide sequences may be determined using one or more computer algorithms or programs known in the art or described herein. For example, percent 5 identity can be determined using the default parameters of the CLUSTAL Valgorithm as incorporated into the MEGALIGN version 3.12e sequence alignment program. This program is part of the LASERGENE software package, a suite of molecular biological analysis programs (DNASTAR, Madison, Wis.). CLUSTAL V is described in Higgins, D. G. and P. M.Sharp (1989;CABIOS 5:151-153) and in Higgins, D. G. et al. (1992; CABIOS 8:189-191). For pairwise 10 alignments of polynucleotide sequences, the default parameters are set as follows: Ktuple=2, gap penalty=5, window=4, and "diagonals saved"=4. The "weighted" residue weight table is selected as the default.
[0050] Alternatively, a suite of commonly used and freely available sequence comparison algorithms which can be used is provided by the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al.(1990) J. Mol. Biol.215:403-410), which is available from several sources, including the NCBI, Bethesda, Md., and on the NCBI World Wide Web site available on the Internet. The BLAST software suite includes various sequence analysis programs including "blastn," that is used to align a known polynucleotide sequence with other polynucleotide sequences from a variety of databases. Also available is a tool called "BLAST 2 Sequences" that is used for direct pairwise comparison of two nucleotide sequences. "BLAST 2 Sequences" can be accessed and used interactively on the Internet via the NCBI World Wide Web site as well. The "BLAST 2 Sequences" tool can be used for both blastn and blastp (discussed below). BLAST programs are commonly used with gap and other parameters set to default settings. For example, to compare two nucleotide sequences, one may use blastn with the "BLAST 2 Sequences" tool Version 212 (Apr. 21, 2000) set at default parameters. Such default parameters may be, for example: Matrix:BLOSUM62; Reward for match: 1;Penalty for mismatch: -2; Open Gap: 5 and Extension Gap: 2 penalties; Gap x drop-off: 50;Expect: 10; Word Size: 11; Filter: on.
[0051] Percent identity may be measured over the length of an entire defined sequence, for example, as defined by a particular SEQ ID number, or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined sequence, for instance, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100, or at least 200 contiguous nucleotides. Such lengths are exemplary only, and it is understood that any fragment length supported by the sequences shown herein, in the tables, figures, or sequence listing, may be used to describe a length over which percentage identity may be measured.
[0052] The phrases "percent identity" and "% identity", as applied to polypeptide sequences, refer to the percentage of identical residue matches between at least two polypeptide sequences aligned using a standardized algorithm. Methods of polypeptide sequence alignment are well known. Some alignment methods take into account conservative amino acid substitutions. Such conservative substitutions, explained in more detail above, generally preserve the charge and hydrophobicity at the site of substitution, thus preserving the structure (and therefore function) of the polypeptide. The phrases "percent similarity" and "% similarity", as applied to polypeptide sequences, refer to the percentage of residue matches, including identical residue matches and conservative substitutions, between at least two polypeptide sequences aligned using a standardized algorithm. In contrast, conservative substitutions are not included in the calculation of percent identity between polypeptide sequences.
[0053] Percent identity between polypeptide sequences may be determined using the default parameters of the CLUSTAL V algorithm as incorporated into the MEGALIGNversion 3.12e sequence alignment program (described and referenced above). For pairwise alignments of polypeptide sequences using CLUSTAL V, the default parameters are set as follows: Ktuple=l, gap penalty=3, window=5, and "diagonals saved"=5. The PAM250 matrix is selected as the default residue weight table.
[0054] Alternatively the NCBI BLAST software suite may be used. For example, for a pairwise comparison of two polypeptide sequences, one may use the "BLAST 2 Sequences"tool Version 212 (Apr. 21, 2000) with blastp set at default parameters. Such default parameters may be, for example: Matrix: BLOSUM62; Open Gap: 11 and Extension Gap: 1 penalties; Gap x drop-off: 50;Expect: 10; Word Size: 3; Filter: on.
[0055] Percent identity may be measured over the length of an entire defined polypeptide sequence, for example, as defined by a particular SEQ ID number, or may be measured over a shorter length, for example, over the length of a fragment taken from a larger, defined polypeptide sequence, for instance, a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 70 or at least 150 contiguous residues. Such lengths are exemplary only, and it is understood that any fragment length supported by the sequences shown herein, in the tables, figures or sequence listing, may be used to describe a length over which percentage identity may be measured.
[0056] The term "agent" encompasses any chemical, biochemical, or biological molecule; such as small molecules, proteins, polypeptides, antibodies, nucleic acid molecules including DNA or RNA, and the like.Methods and compositions related to the inventive hEbola [0057] The present invention is based upon the isolation and identification of a new human Ebola virus species, EboBun and the sequencing of the only other known West African Ebola species EboIC. EboBun was isolated from the patients suffering from hemorrhagic fever in a recent outbreak in Uganda. The isolated virus is a member of the Filoviridae family, a family of negative sense RNA viruses. Accordingly, the invention relates to the isolated EboBun or EBOIC virus that morphologically and phylogenetically relates to known members filoviridae.
[0058] In another aspect, the invention provides an isolated hEbola virus including a nucleic acid molecule with a nucleotide sequence that is preferably: a) a nucleotide sequence set forth in SEQ ID NO: 1; b) a nucleotide sequence that hybridizes to the sequence set forth in SEQ ID NO: 1 under stringent conditions; or c) a nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the SEQ ID NO: 1. In one embodiment of the present invention, the hEbola virus is killed. In another, the virus is attenuated. In another, the infectivity of the attenuated hEbola virus is reduced. In another, the infectivity is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, or 10,000-fold. In another, the replication ability of the attenuated hEbola virus is reduced. In another, the replication ability of the attenuated virus is educed by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold. In another, the protein synthesis ability of the attenuated virus is reduced. In another, the protein synthesis ability is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold. In another, the assembling ability of the attenuated hEbola virus is reduced. In another, the assembling ability of the attenuated virus is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold. In another, the cytopathic effect of the attenuated hEbola virus is reduced. In another, the cytopathic effect is reduced by at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold, or 10,000-fold.
[0059] In another aspect, the invention provides the complete genomic sequence of the hEbola virus EboBun or EboIC. In a specific embodiment, the virus includes a nucleotide sequence of SEQID NOs: 1 or 10, respectively.
[0060] In a related aspect, the invention provides nucleic acid molecules isolated from EboBun, EboIC, or fragments thereof. In one embodiment of the present invention, the isolated nucleic acid molecule includes the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof. In another, the nucleic acid molecule includes a nucleotide sequence having at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, or 4900 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 1, or a complement thereof;with the proviso that the nucleotide sequence is not comprised by the nucleotide sequence set forth in SEQ ID NO: 20 (Ebola Zaire nucleotide sequence); or at least 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, or 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof. In another embodiment, the isolated nucleic acid molecule includes a nucleotide sequence that encodes the EboBun amino acid sequence of SEQ ID NOs: 2-9 or 59, the EboIC amino acid sequence of SEQ ID NOs: 11-19, or a complement of the nucleotide sequence that encodes the EboBun amino acid sequences of SEQID NOs: 2-9 or 59 or the EboIC amino acid sequences of SEQ ID NOs: 11-19. In another, the isolated nucleic acid molecule hybridizes under stringent conditions to a nucleic acid molecule having the nucleotide sequence of SEQ ID NOs: 1 or 10 or a complement thereof, wherein the nucleic acid molecule encodes an amino acid sequence which has a biological activity exhibited by a polypeptide encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10. In another, nucleic acid molecule is RNA. In another, nucleic acid molecule is DNA.
[0061] In another aspect, the invention provides proteins or polypeptides that are isolated from the EboBun, including viral proteins isolated from cells infected with the virus but not present in comparable uninfected cells. In one embodiment of the present invention, the amino acid sequences of the proteins or polypeptides are set forth in SEQ ID NOs: 2-9, 59, or 11-19, or fragments thereof.In one embodiment, polypeptides or proteins of the present invention have a biological activity of the protein (including antigenicity and/or immunogenicity) encoded by the sequence of SEQ IDNOs: 1 or 10. In another, the polypeptides or the proteins of the present invention have a biological activity of at least one protein having the amino acid sequence (including antigenicity and/or immunogenicity) set forth in SEQ ID NOS: 2-9, 59, or 11-19, or a fragment thereof.
[0062] In a related aspect, the invention provides an isolated polypeptide encoded by the nucleic acid molecule of the invention described above. In one embodiment of the present invention, the isolated polypeptide includes the amino acid sequence selected from the group consisting of: a) an amino acid sequence set forth in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, or 9; 11, 12, 13, 14, 15, 16, 17, 18 or 19; and b) an amino acid sequence that has 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology to the amino acid sequence according to a). In another, the isolated polypeptide comprises the amino acid sequence having at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 210, 220, 230, 240 or 250 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 5 or 18 (VP24); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 210, 220, 230, 240, 250, 260, 270, 280 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 6 or 17 (VP30); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, or 320 contiguous amino acid residues of the amino acid sequence of SEQID NOs: 8 or 13 (VP40); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, or 340 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 7 or 12 (VP35); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 360, or 370 contiguous amino acid residues of the amino acid sequence of SEQ IDNOs: 4 or 15 (SGP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 360, or 370 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 59 or 16 (SSGP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 610, 620, 630, 640, 650, 660, or 670 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 9 or 14 (GP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 650, 700, 710, 720, or 730 contiguous amino acid residues of the amino acid sequence of SEQID NOs: 3 or 11 (NP); or 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2160, 2170, 2180, 2190, or 2200 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs: 2 or 19 (L).
[0063] In other aspects, the invention relates to the use of an isolated West African hEbola virus for diagnostic and therapeutic methods. In one embodiment, the invention provides a method of detecting in a biological sample an antibody immunospecific for the hEbola virus using the inventive isolated hEbola virus described herein, or any of the inventive proteins or polypeptides as described herein. In another specific embodiment, the invention provides a method of screening for an antibody which immunospecifically binds and neutralizes hEbola EboBun or EboICor a combination thereof. Such an antibody is useful for a passive immunization or immunotherapy of a subject infected with hEbola.
[0064] In another aspect, the invention provides an isolated antibody or an antigen-binding fragment thereof which immunospecifically binds to a West African genus hEbola virus of the 5 invention described above, and illustratively including EboBun or EboIC. In one embodiment of the present invention, the isolated antibody or an antigen-binding fragment thereof neutralizes a West African genus hEbola virus. In another, the isolated antibody or an antigen-binding fragment thereof immunospecifically binds to the inventive polypeptide described above. The invention further provides antibodies that specifically bind a polypeptide of the invention encoded by the nucleotide 10 sequence of SEQ ID NOs: 1 (EboBun) or 10 (EboIC), a fragment thereof, or encoded by a nucleic acid comprising a nucleotide sequence that hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NOs: 1 (EboBun) or 10 (EboIC) and/or any hEbola EboBun epitope, having one or more biological activities of a polypeptide of the invention. These polypeptides include those shown in SEQ ID NOs: 2-9, 59, and 11-19. Such antibodies include, but are not limited to, 15 polyclonal, monoclonal, bi-specific, multi-specific, human, humanized, chimeric antibodies, single chain antibodies, Fab fragments, F(ab')2 fragments, disulfide-linked Fvs, intrabodies and fragments containing either a VL or VH domain or even a complementary determining region (CDR) that specifically binds to a polypeptide of the invention.
[0065] In other aspects, the invention provides methods for detecting the presence, activity or expression of the hEbola virus of the invention in a biological material, such as cells, blood, saliva, urine, and so forth. The increased or decreased activity or expression of the hEbola virus in a sample relative to a control sample can be determined by contacting the biological material with an agent which can detect directly or indirectly the presence, activity or expression of the hEbola virus.In one embodiment of the present invention, the detecting agents are the antibodies or nucleic acid molecules of the present invention. Antibodies of the invention can also be used to treat hemorrhagic fever.
[0066] In a related aspect, the invention provides a method for detecting the presence of the inventive hEbola virus described above in a biological sample, the method comprising:(a) contacting the sample with an agent that selectively binds to the hEbola virus; and (b) detecting whether the compound binds to the hEbola virus in the sample. In one embodiment of the present invention, the biological sample is selected from the group consisting of cells; blood; serum; plasma;feces; rectal, vaginal and conjunctival swabs In another, the agent that binds to the virus is an antibody. In another, the agent that binds to the virus is a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1 or a complement thereof. In another, the agent that binds to the virus is a nucleic acid molecule comprising a nucleotide sequence having at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, or 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof.
[0067] In another aspect, the invention provides a method for detecting the presence of the inventive polypeptide described above, in a biological sample, the method comprising:(a) contacting the biological sample with an agent that selectively binds to the polypeptide; and (b) detecting whether the agent binds to the polypeptide in the sample. In one embodiment of the present invention, the biological sample is selected from the group consisting of cells; blood; serum;plasma; feces; rectal, vaginal and conjunctival swabs. In another, the agent that binds to the polypeptide is an antibody or an antigen-binding fragment thereof.
[0068] In another aspect, the invention provides a method for detecting the presence of a first nucleic acid molecule derived from the inventive hEbola virus described above in a biological sample, the method includes (a) contacting the biological sample with an agent that selectively binds to the nucleic acid; and (b) detecting whether the agent binds to the nucleotide in the sample. In one embodiment of the present invention, the agent that binds to the first nucleic acid molecule is a second nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:1 or a complement thereof. In another, the second nucleic acid molecule comprises at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, or 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof.
[0069] In another aspect, the invention provides a method for propagating the hEbola virus in host cells comprising infecting the host cells with an inventive isolated West African hEbola virus described above, culturing the host cells to allow the virus to multiply, and harvesting the resulting virions. Also provided by the present invention are host cells infected with the inventive hEbola virus described above. In one embodiment of the present invention, the host cell is a primate cell.
[0070] In another aspect, the invention provides a method of detecting in a biological sample the presence of an antibody that immunospecifically binds hEbola virus, the method includes: (a) contacting the biological sample with the inventive host cell described above;and (b) detecting the antibody bound to the cell.
[0071] In another aspect, the invention provides vaccine preparations, including the inventive hEbola virus, including recombinant and chimeric forms of the virus, nucleic acid molecules comprised by the virus, or protein subunits of the virus. In one embodiment, the vaccine preparations of the present invention includes live but attenuated hEbola virus with or without pharmaceutically acceptable carriers, including adjuvants. In another, the vaccine preparations of the invention comprise an inactivated or killed hEbola EboBun virus, EboICvirus, or a combination thereof, with or without pharmaceutically acceptable carriers, including adjuvants. Such attenuated or inactivated viruses may be prepared by a series of passages of the virus through the host cells or by preparing recombinant or chimeric forms of virus. Accordingly, the present invention further provides methods of preparing recombinant or chimeric forms of the inventive hEbola viruses described herein.
[0072] In another specific embodiment, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the inventive hEbola virus described above, or a subunit thereof;and a pharmaceutically acceptable carrier. In another aspect, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of inventive the nucleotide sequences as described above, or a complement thereof, and a pharmaceutically acceptable carrier. In another aspect, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the inventive hEbola virus described above, or a subunit thereof; and a pharmaceutically acceptable carrier. In another aspect, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof, and a pharmaceutically acceptable carrier. In another, the invention provides a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of inventive the nucleotide sequences as described above, or a complement thereof, and a pharmaceutically acceptable carrier.
[0073] In yet another specific embodiment, the vaccine preparations of the present invention comprise a nucleic acid or fragment of the hEbola virus, e.g., the virus having Accession No.200706291, or nucleic acid molecules having the sequence of SEQ ID NOs: 1 or 10, or a fragment thereof. In another, the vaccine preparations comprise a polypeptide of the invention encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10 or a fragment thereof. In a specific embodiment, the vaccine preparations comprise polypeptides of the invention as shown in SEQ IDNOs: 2-9, 59, or 11-19, or encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10, or a fragment thereof.
[0074] Furthermore, the present invention provides methods for treating, ameliorating, managing or preventing hemorrhagic fever by administering the vaccine preparations or antibodies of the present invention alone or in combination with adjuvants, or other pharmaceutically acceptable excipients. Furthermore, the present invention provides methods for treating, ameliorating, managing, or preventing hemorrhagic fever by administering the inventive compositions and formulations including the vaccine preparations or antibodies of the present invention alone or in combination with antivirals [e.g., amantadine, rimantadine, gancyclovir, acyclovir, ribavirin, penciclovir, oseltamivir, foscamet zidovudine (AZT), didanosine (ddl), lamivudine (3TC), zalcitabine (ddC), stavudine (d4T), nevirapine, delavirdine, indinavir, ritonavir, vidarabine, nelfinavir, saquinavir, relenza, tamiflu, pleconaril, interferons, etc.], steroids and corticosteroids such as prednisone, cortisone, fluticasone and glucocorticoid, antibiotics, analgesics, bronchodilators, or other treatments for respiratory and/or viral infections.
[0075] In a related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of the inventive hEbola virus described above, and a pharmaceutically acceptable carrier.
[0076] In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a protein extract of the inventive hEbola virus described above or a subunit thereof, and a pharmaceutically acceptable carrier.
[0077] In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1, 10, a combination thereof, or a complement thereof, and a pharmaceutically acceptable carrier.
[0078] In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising the inventive nucleotide sequence as described above or a complement thereof, and a pharmaceutically acceptable carrier.
[0079] In another related aspect, the invention provides an immunogenic formulation comprising an immunogenically effective amount of any of the inventive polypeptides described above.
[0080] In another aspect, the present invention provides pharmaceutical compositions comprising antiviral agents of the present invention and a pharmaceutically acceptable carrier. In a specific embodiment, the antiviral agent of the invention is an antibody that immunospecifically binds hEbola virus or any hEbola epitope. In another specific embodiment, the antiviral agent is a polypeptide or protein of the present invention or nucleic acid molecule of the invention.
[0081] In a related aspect, the invention provides a pharmaceutical composition comprising a prophylactically or therapeutically effective amount of an anti-hEbola EboBun agent and a pharmaceutically acceptable carrier. In one embodiment of the present invention, the anti-hEbola EboBun agent is an antibody or an antigen-binding fragment thereof which immunospecifically binds to the hEbola virus of Deposit Accession No. 200706291, or polypeptides or protein derived therefrom. In another, the anti-hEbola agent is a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1, 10, a combination thereof, or a fragment thereof.In another, the anti-hEbola agent is a polypeptide encoded by a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1, 10, a combination thereof, or a fragment thereof having a biological activity of the polypeptide.
[0082] The invention also provides kits containing compositions and formulations of the present invention. Thus, in another aspect, the invention provides a kit comprising a container containing the inventive immunogenic formulation described above.
[0083] In another aspect, the invention provides a kit includes a container containing the inventive vaccine formulation described above.
[0084] In another aspect, the invention provides a kit including a container containing the inventive pharmaceutical composition described above.
[0085] In another aspect, the invention provides a kit including a container containing the inventive vaccine formulation described above.
[0086] In another aspect, the invention provides a method for identifying a subject infected with the inventive hEbola virus described above, including: (a) obtaining total RNAfrom a biological sample obtained from the subject; (b) reverse transcribing the total RNA to obtain cDNA; and (c) amplifying the cDNA using a set of primers derived from a nucleotide sequence of the inventive 5 hEbola virus described above.
[0087] In one embodiment of the present invention, the set of primers are derived from the nucleotide sequence of the genome of the hEbola virus of Deposit Accession No.200706291. In another, the set of primers are derived from the nucleotide sequence of SEQ IDNOs: 1 or 10 or any of the inventive nucleotide sequences as described above, or a complement thereof.10 [0088] The invention further relates to the use of the sequence information of the isolated virus for diagnostic and therapeutic methods. In a specific embodiment, the invention provides nucleic acid molecules which are suitable for use as primers consisting of or including the nucleotide sequence of SEQ ID NOs: 1 or 10, or a complement thereof, or at least a portion of the nucleotide sequence thereof. In another specific embodiment, the invention provides nucleic acid molecules 15 which are suitable for hybridization to the inventive hEbola nucleic acid;including, but not limited to PCR primers, Reverse Transcriptase primers, probes for Southern analysis or other nucleic acid hybridization analysis for the detection of hEbola nucleic acids, e.g., consisting of or including the nucleotide sequence of SEQ ID NOs: 1, 10 a combination thereof, a complement thereof, or a portion thereof. The invention further encompasses chimeric or recombinant viruses encoded in 20 whole or in part by the nucleotide sequences.[0089] In another aspect, the present invention provides methods for screening antiviral agents that inhibit the infectivity or replication of hEbola virus or variants thereof.[0090] The invention further provides methods of preparing recombinant or chimeric forms of hEbola.[0091] In another aspect, the invention provides vaccine preparations including the hEbola virus, including recombinant and chimeric forms of the virus, or subunits of the virus. The present invention encompasses recombinant or chimeric viruses encoded by viral vectors derived from the genome of the inventive hEbola virus described herein or natural variants thereof. In a specific embodiment, a recombinant virus is one derived from the hEbola virus of Deposit Accession No.200706291. It is recognized that natural variants of the inventive hEbola viruses described herein comprise one or more mutations, including, but not limited to, point mutations, rearrangements, insertions, deletions etc., to the genomic sequence. It is recognized that the mutations may or may not result in a phenotypic change.[0092] In another specific embodiment, a chimeric virus of the invention is a recombinant hEbola EboBun or EboIC virus which further comprises a heterologous nucleotide sequence. In accordance with the invention, a chimeric virus may be encoded by a nucleotide sequence in which heterologous nucleotide sequences have been added to the genome or in which endogenous or native nucleotide sequences have been replaced with heterologous nucleotide sequences.[0093] According to the present invention, the chimeric viruses are encoded by the viral vectors of the invention which further comprise a heterologous nucleotide sequence. In accordance with the present invention a chimeric virus is encoded by a viral vector that may or may not include nucleic acids that are non-native to the viral genome. In accordance with the invention a chimeric virus is encoded by a viral vector to which heterologous nucleotide sequences have been added, inserted or substituted for native or non-native sequences. In accordance with the present invention, the chimeric virus may be encoded by nucleotide sequences derived from different species or variants of hEbola virus. In particular, the chimeric virus is encoded by nucleotide sequences that encode antigenic polypeptides derived from different species or variants of hEbola virus.[0094] A chimeric virus may be of particular use for the generation of recombinant vaccines protecting against two or more viruses (Tao et al., J. Virol. 72, 2955-2961;Durbin et al., 2000, J.Virol. 74, 6821-6831; Skiadopoulos et al., 1998, J. Virol. 72, 1762-1768 (1998); Teng et al., 2000, J.Virol. 74, 9317-9321). For example, it can be envisaged that a virus vector derived from the hEbola virus expressing one or more proteins of variants of hEbola virus including hEbola EboBun, or vice versa, will protect a subject vaccinated with such vector against infections by both the native hEbola and the variant. Attenuated and replication-defective viruses may be of use for vaccination purposes with live vaccines as has been suggested for other viruses. (See, for example, PCT WO 02/057302, at pp. 6 and 23; and United States Patent Application Publication 2008/0069838 incorporated by reference herein).[0095] In accordance with the present invention the heterologous sequence to be incorporated into the viral vectors encoding the recombinant or chimeric viruses of the invention include sequences obtained or derived from different species or variants of hEbola.[0096] In certain embodiments, the chimeric or recombinant viruses of the invention are encoded by viral vectors derived from viral genomes wherein one or more sequences, intergenic regions, termini sequences, or portions or entire ORF have been substituted with a heterologous or non-native sequence. In certain embodiments of the invention, the chimeric viruses of the invention are encoded by viral vectors derived from viral genomes wherein one or more heterologous sequences have been inserted or added to the vector.[0097] The selection of the viral vector may depend on the species of the subject that is to be treated or protected from a viral infection. If the subject is human, then an attenuated hEbola virus can be used to provide the antigenic sequences.[0098] In accordance with the present invention, the viral vectors can be engineered to provide antigenic sequences which confer protection against infection by the inventive hEbola and natural variants thereof. The viral vectors may be engineered to provide one, two, three or more antigenic sequences. In accordance with the present invention the antigenic sequences may be derived from the same virus, from different species or variants of the same type of virus, or from different viruses.[0099] The expression products and/or recombinant or chimeric virions obtained in accordance with the invention may advantageously be utilized in vaccine formulations. The expression products and chimeric virions of the present invention may be engineered to create vaccines against a broad range of pathogens, including viral and bacterial antigens, tumor antigens, allergen antigens, and auto antigens involved in autoimmune disorders. One way to achieve this goal involves modifying existing hEbola genes to contain foreign sequences in their respective external domains. Where the heterologous sequences are epitopes or antigens of pathogens, these chimeric viruses may be used to induce a protective immune response against the disease agent from which these determinants are derived. In particular, the chimeric virions of the present invention may be engineered to create vaccines for the protection of a subject from infections with hEbola virus and variants thereof.[00100] Thus, the present invention further relates to the use of viral vectors and recombinant or chimeric viruses to formulate vaccines against a broad range of viruses and/or antigens. The present invention also encompasses recombinant viruses including a viral vector derived from the hEbola or variants thereof which contains sequences which result in a virus having a phenotype more suitable for use in vaccine formulations, e.g., attenuated phenotype or enhanced antigenicity. The mutations and modifications can be in coding regions, in intergenic regions and in the leader and trailer sequences of the virus.[00101] The invention provides a host cell including a nucleic acid or a vector according to the invention. Plasmid or viral vectors containing the polymerase components of hEbola virus are generated in prokaryotic cells for the expression of the components in relevant cell types (bacteria, insect cells, eukaryotic cells). Plasmid or viral vectors containing full-length or partial copies of the hEbola genome will be generated in prokaryotic cells for the expression of viral nucleic acids in vitro or in vivo. The latter vectors optionally contain other viral sequences for the generation of chimeric viruses or chimeric virus proteins, optionally lack parts of the viral genome for the generation of replication defective virus, and optionally contain mutations, deletions or insertions for the generation of attenuated viruses. In addition, the present invention provides a host cell infected with hEbola virus of Deposit Accession No. 200706291, [00102] Infectious copies of West African hEbola (being wild type, attenuated, replication-defective or chimeric) are optionally produced upon co-expression of the polymerase components according to the state-of-the-art technologies described above.[0100] In addition, eukaryotic cells, transiently or stably expressing one or more full-length or partial hEbola proteins are optionally used. Such cells are preferably made by transfection (proteins or nucleic acid vectors), infection (viral vectors) or transduction (viral vectors) and are useful for complementation of mentioned wild type, attenuated, replication-defective or chimeric viruses.[0101] The viral vectors and chimeric viruses of the present invention optionally modulate a subject's immune system by stimulating a humoral immune response, a cellular immune response or by stimulating tolerance to an antigen. As used herein, a subject means:humans, primates, horses, cows, sheep, pigs, goats, dogs, cats, avian species and rodents.
Formulation of Vaccines and Antivirals [0102] In a preferred embodiment, the invention provides a proteinaceous molecule or hEbola virus specific viral protein or functional fragment thereof encoded by a nucleic acid according to the invention. Useful proteinaceous molecules are for example derived from any of the genes or genomic fragments derivable from the virus according to the invention, preferably the GP, L, NP, sGP, VP24, VP30, VP35, and VP 40 proteins described herein. Such molecules, or antigenic fragments thereof, as provided herein, are for example useful in diagnostic methods or kits and in pharmaceutical compositions such as subunit vaccines. Particularly useful are polypeptides encoded by the nucleotide sequence of SEQ ID NOs: 1 or 10; or antigenic fragments thereof for inclusion as antigen or subunit immunogen, but inactivated whole virus can also be used.Particularly useful are also those proteinaceous substances that are encoded by recombinant nucleic acid fragments of the hEbola genome, of course preferred are those that are within the preferred bounds and metes of ORFs, in particular, for eliciting hEbola specific antibody or T cell responses, whether in vivo (e.g.
for protective or therapeutic purposes or for providing diagnostic antibodies) or in vitro (e.g. by phage display technology or another technique useful for generating synthetic antibodies).[0103] It is recognized that numerous variants, analogues, or homologues of EboBun polypeptides are within the scope of the present invention including amino acid substitutions, alterations, modifications, or other amino acid changes that increase, decrease, or do not alter the function or immunogenic propensity of the inventive immunogen or vaccine.Several post-translational modifications are similarly envisioned as within the scope of the present invention illustratively including incorporation of a non-naturally occurring amino acid(s), phosphorylation, glycosylation, sulfation, and addition of pendent groups such as biotynlation, fluorophores, lumiphores, radioactive groups, antigens, or other molecules.[0104] Methods of expressing and purifying natural or recombinant peptides and proteins are well known in the art. Illustratively, peptides and proteins are recombinantly expressed in eukaryotic cells. Exemplary eukaryotic cells include yeast, HeLa cells, 293 cells, COS cells, Chinese hamster ovary cells (CHO), and many other cell types known in the art.Both eukaryotic and prokaryotic expression systems and cells are available illustratively from Invitrogen Corp., Carlsbad, CA. It is appreciated that cell-free expression systems are similarly operable.[0105] In a preferred embodiment an immunogenic polypeptide is a full length EboBun protein.Preferably, an immunogen is a full length EboBun protein of SEQ ID NOs: 2-9 or 59, or EboIC SEQID NOs: 11-19, or a fragment thereof as described herein. Preferably, an immunogen is has a minimum of 5 amino acids. As used herein an immunogen is preferably a polypeptide. In the context of an immunogenic polypeptide the terms immunogen, polypeptide, and antigen are used interchangeably.[0106] Modifications and changes can be made in the structure of the inventive immunogens that are the subject of the application and still obtain a molecule having similar or improved characteristics as the wild-type sequence (e.g., a conservative amino acid substitution). For example, certain amino acids are optionally substituted for other amino acids in a sequence without appreciable loss of immunogenic activity. Because it is the interactive capacity and nature of a polypeptide that defines that polypeptide's biological functional activity, certain amino acid sequence substitutions can be made in a polypeptide sequence and nevertheless obtain a polypeptide with like or improved properties. Optionally, a polypeptide is used that has less or more immunogenic activity compared to the wild-type sequence.
[0107] In making such changes, the hydropathic index of amino acids is preferably considered.The importance of the hydropathic amino acid index in conferring interactive biologic function on a polypeptide is generally understood in the art. It is known that certain amino acids can be substituted for other amino acids having a similar hydropathic index or score and still result in a 5 polypeptide with similar biological activity. Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics. Those indices are: isoleucine (+4.5);valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cysteine (+2.5);methionine (+1.9);alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3);proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5);aspartate (-3.5); asparagine (-3.5);10 lysine (-3.9); and arginine (-4.5).[0108] It is believed that the relative hydropathic character of the amino acid determines the secondary structure of the resultant polypeptide, which in turn defines the interaction of the polypeptide with other molecules, such as enzymes, substrates, receptors, antibodies, antigens, and the like. It is known in the art that an amino acid can be substituted by another amino acid having a 15 similar hydropathic index and still obtain a functionally equivalent immunogen. In such changes, the substitution of amino acids whose hydropathic indices are within 2 is preferred, those within 1 are particularly preferred, and those within 0.5 are even more particularly preferred.[0109] As outlined above, amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, 20 size, and the like. Exemplary substitutions that take various of the foregoing characteristics into consideration are well known to those of skill in the art and include (original residue: exemplary substitution): (Ala: Gly, Ser), (Arg: Lys), (Asn: Gln, His), (Asp: Glu, Cys, Ser), (Gln: Asn), (Glu:Asp), (Gly: Ala), (His: Asn, Gln), (Ile: Leu, Val), (Leu: Ile, Val), (Lys:Arg), (Met: Leu, Tyr), (Ser:Thr), (Thr: Ser), (Tip: Tyr), (Tyr: Trp, Phe), and (Val: Ile, Leu).Embodiments of this disclosure 25 thus contemplate functional or biological equivalents of a polypeptide and immunogen as set forth above. In particular, embodiments of the polypeptides and immunogens optionally include variants having about 50%, 60%, 70%, 80%, 90%, and 95% sequence identity to the polypeptide of interest.[0110] The invention provides vaccine formulations for the prevention and treatment of infections with hEbola virus. In certain embodiments, the vaccine of the invention comprises recombinant and chimeric viruses of the hEbola virus. In certain embodiments, the virus is attenuated.
[0111] In another embodiment of this aspect of the invention, inactivated vaccine formulations are prepared using conventional techniques to "kill" the chimeric viruses.Inactivated vaccines are "dead" in the sense that their infectivity has been destroyed. Ideally, the infectivity of the virus is destroyed without affecting its immunogenicity. In order to prepare inactivated vaccines, the chimeric virus may be grown in cell culture or in the allantois of the chick embryo, purified by zonal ultracentrifugation, inactivated by formaldehyde or (3-propiolactone, and pooled. The resulting vaccine is usually inoculated intramuscularly or intranasally.[0112] Inactivated viruses are optionally formulated with a suitable adjuvant in order to enhance the immunological response. Such adjuvants illustratively include but are not limited to mineral gels, e.g., aluminum hydroxide; surface active substances such as lysolecithin, pluronic polyols, polyanions; peptides; oil emulsions; and potentially useful human adjuvants such as BCG and Corynebacterium parvum.[0113] In another aspect, the present invention also provides DNA vaccine formulations including a nucleic acid or fragment of the inventive hEbola virus, e.g., the virus having Accession No. 200706291, or nucleic acid molecules having the sequence of SEQ ID NOs: 1 or 10, or a fragment thereof. In another specific embodiment, the DNA vaccine formulations of the present invention comprise a nucleic acid or fragment thereof encoding the antibodies which immunospecifically bind hEbola viruses. In DNA vaccine formulations, a vaccine DNA comprises a viral vector, such as that derived from the hEbola virus, bacterial plasmid, or other expression vector, bearing an insert including a nucleic acid molecule of the present invention operably linked to one or more control elements, thereby allowing expression of the vaccinating proteins encoded by the nucleic acid molecule in a vaccinated subject. Such vectors can be prepared by recombinant DNA technology as recombinant or chimeric viral vectors carrying a nucleic acid molecule of the present invention.[0114] A nucleic acid as used herein refers to single- or double-stranded molecules which are optionally DNA, including the nucleotide bases A, T, C and G, or RNA, including the bases A, U(substitutes for T), C, and G. The nucleic acid may represent a coding strand or its complement.Nucleic acids are optionally identical in sequence to the sequence which is naturally occurring or include alternative codons which encode the same amino acid as that which is found in the naturally occurring sequence. Furthermore, nucleic acids optionally include codons which represent conservative substitutions of amino acids as are well known in the art.
[0115] As used herein, the term "isolated nucleic acid" means a nucleic acid separated or substantially free from at least some of the other components of the naturally occurring organism, for example, the cell structural components commonly found associated with nucleic acids in a cellular environment and/or other nucleic acids. The isolation of nucleic acids is illustratively accomplished by techniques such as cell lysis followed by phenol plus chloroform extraction, followed by ethanol precipitation of the nucleic acids. The nucleic acids of this invention are illustratively isolated from cells according to methods well known in the art for isolating nucleic acids. Alternatively, the nucleic acids of the present invention are optionally synthesized according to standard protocols well described in the literature for synthesizing nucleic acids. Modifications to the nucleic acids of the invention are also contemplated, provided that the essential structure and function of the peptide or polypeptide encoded by the nucleic acid are maintained.[0116] The nucleic acid encoding the peptide or polypeptide of this invention is optionally part of a recombinant nucleic acid construct comprising any combination of restriction sites and/or functional elements as are well known in the art which facilitate molecular cloning and other recombinant DNA manipulations. Thus, the present invention further provides a recombinant nucleic acid construct including a nucleic acid encoding a polypeptide of this invention.[0117] Generally, it may be more convenient to employ as the recombinant polynucleotide a cDNA version of the polynucleotide. It is believed that the use of a cDNAversion will provide advantages in that the size of the gene will generally be much smaller and more readily employed to transfect the targeted cell than will a genomic gene, which will typically be up to an order of magnitude larger than the cDNA gene. However, the inventor does not exclude the possibility of employing a genomic version of a particular gene where desired.[0118] As used herein, the terms "engineered" and "recombinant" cells are synonymous with "host" cells and are intended to refer to a cell into which an exogenous DNAsegment or gene, such as a cDNA or gene has been introduced. Therefore, engineered cells are distinguishable from naturally occurring cells which do not contain a recombinantly introduced exogenous DNA segment or gene. A host cell is optionally a naturally occurring cell that is transformed with an exogenous DNA segment or gene or a cell that is not modified. A host cell preferably does not possess a naturally occurring gene encoding RSV G protein. Engineered cells are, thus, cells having a gene or genes introduced through the hand of man. Recombinant cells illustratively include those having an introduced cDNA or genomic DNA, and also include genes positioned adjacent to a promoter not naturally associated with the particular introduced gene.
[0119] To express a recombinant encoded polypeptide in accordance with the present invention one optionally prepares an expression vector that comprises a polynucleotide under the control of one or more promoters. To bring a coding sequence "under the control of' a promoter, one positions the 5' end of the translational initiation site of the reading frame generally between about 1 and 50 nucleotides "downstream" of (i.e., 3' of) the chosen promoter. The "upstream"promoter stimulates transcription of the inserted DNA and promotes expression of the encoded recombinant protein.This is the meaning of "recombinant expression" in the context used here.[0120] Many standard techniques are available to construct expression vectors containing the appropriate nucleic acids and transcriptional/translational control sequences in order to achieve protein or peptide expression in a variety of host-expression systems. Cell types available for expression include, but are not limited to, bacteria, such as E. coli and B.subtilis transformed with recombinant phage DNA, plasmid DNA or cosmid DNA expression vectors.[0121] Certain examples of prokaryotic hosts illustratively include E. coli strain RR1, E. coli LE392, E. coli B, E. coli 1776 (ATCC No. 31537) as well as E. coli W3110 (F-, lambda-, prototrophic, ATCC No. 273325); bacilli such as Bacillus subtilis; and other enterobacteria such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas species.[0122] In general, plasmid vectors containing replicon and control sequences that are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication site, as well as marking sequences that are capable of providing phenotypic selection in transformed cells. For example, E. coli is often transformed using pBR322, a plasmid derived from an E. coli species. Plasmid pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The pBR322 plasmid, or other microbial plasmid or phage may also contain, or be modified to contain, promoters that can be used by the microbial organism for expression of its own proteins.[0123] In addition, phage vectors containing replicon and control sequences that are compatible with the host microorganism are optionally used as transforming vectors in connection with these hosts. For example, the phage lambda is optionally utilized in making a recombinant phage vector that can be used to transform host cells, such as E. coli LE392.[0124] Further useful vectors include pIN vectors and pGEX vectors, for use in generating glutathione S-transferase (GST) soluble fusion proteins for later purification and separation or cleavage. Other suitable fusion proteins are those with (3-galactosidase, ubiquitin, or the like.
[0125] Promoters that are most commonly used in recombinant DNA construction include the (3-lactamase (penicillinase), lactose and tryptophan (trp) promoter systems.While these are the most commonly used, other microbial promoters have been discovered and utilized, and details concerning their nucleotide sequences have been published, enabling those of skill in the art to ligate them functionally with plasmid vectors.[0126] For expression in Saccharomyces, the plasmid YRp7, for example, is commonly used.This plasmid contains the trpl gene, which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1. The presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.[0127] Suitable promoting sequences in yeast vectors illustratively include the promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. In constructing suitable expression plasmids, the termination sequences associated with these genes are also preferably ligated into the expression vector 3' of the sequence desired to be expressed to provide polyadenylation of the mRNA and termination.[0128] Other suitable promoters, which have the additional advantage of transcription controlled by growth conditions, illustratively include the promoter region for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization.[0129] In addition to microorganisms, cultures of cells derived from multicellular organisms are also operable as hosts. In principle, any such cell culture is operable, whether from vertebrate or invertebrate culture. In addition to mammalian cells, these include insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus); and plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV;tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing one or more coding sequences.[0130] In a useful insect system, Autographica californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The isolated nucleic acid coding sequences are cloned into non-essential regions (for example the polyhedron gene) of the virus and placed under control of an AcNPV promoter (for example, the polyhedron promoter). Successful insertion of the coding sequences results in the inactivation of the polyhedron gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedron gene). These recombinant viruses are then used to 5 infect Spodoptera frugiperda cells in which the inserted gene is expressed (e.g., U.S. Patent No.4,215,051).[0131] Examples of useful mammalian host cell lines include VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, W138, BHK, COS-7, 293, HepG2, NIH3T3, RIN and MDCK cell lines. In addition, a host cell is preferably chosen that modulates the expression of the inserted 10 sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the encoded protein.[0132] Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cell lines or host systems are 15 preferably chosen to ensure the correct modification and processing of the foreign protein expressed.Expression vectors for use in mammalian cells ordinarily include an origin of replication (as necessary), a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation site, and transcriptional terminator sequences. The origin of replication is preferably provided either by construction of the vector to 20 include an exogenous origin, such as may be derived from SV40 or other viral (e.g., Polyoma, Adeno, VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.[0133] The promoters are optionally derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the 25 vaccinia virus 7.5K promoter). Further, it is also possible, and may be desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell systems.[0134] A number of viral based expression systems are operable herein, for example, commonly used promoters are derived from polyoma, Adenovirus 2, Adenovirus 5, cytomegalovirus and 30 Simian Virus 40 (SV40). The early and late promoters of SV40 virus are useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication.Smaller or larger SV40 fragments are also operable, particularly when there is included the approximately 250 bp sequence extending from the HindIll site toward the Bgll site located in the viral origin of replication.[0135] In cases where an adenovirus is used as an expression vector, the coding sequences are preferably ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene is then optionally inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing proteins in infected hosts.[0136] Specific initiation signals may also be required for efficient translation of the claimed isolated nucleic acid coding sequences. These signals include the ATGinitiation codon and adjacent sequences. Exogenous translational control signals, including the ATGinitiation codon, may additionally need to be provided. One of ordinary skill in the art would readily be capable of determining this need and providing the necessary signals. It is well known that the initiation codon must be in-frame (or in-phase) with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons are optionally of a variety of origins, both natural and synthetic. The efficiency of expression is optionally enhanced by the inclusion of appropriate transcription enhancer elements or transcription terminators.[0137] In eukaryotic expression, one will also typically desire to incorporate into the transcriptional unit an appropriate polyadenylation site if one was not contained within the original cloned segment. Typically, the poly A addition site is placed about 30 to 2000 nucleotides "downstream" of the termination site of the protein at a position prior to transcription termination.[0138] For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines that stably express constructs encoding proteins are engineered.Rather than using expression vectors that contain viral origins of replication, host cells are preferably transformed with vectors controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.Following the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched medium, and then are switched to a selective medium. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci, which in turn can be cloned and expanded into cell lines.
[0139] A number of selection systems are illustratively used, including, but not limited, to the herpes simplex virus thymidine kinase, hypoxanthine-guanine phosphoribosyltransferase and adenine phosphoribosyltransferase genes, in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite resistance is optionally used as the basis of selection for dhfr, which confers resistance to methotrexate; gpt, which confers resistance to mycophenolic acid; neo, which confers resistance to the aminoglycoside G-418; and hygro, which confers resistance to hygromycin. It is appreciated that numerous other selection systems are known in the art that are similarly operable in the present invention.[0140] The nucleic acids encoding the peptides and polypeptides of this invention are optionally administered as nucleic acid vaccines. For the purposes of vaccine delivery, a nucleic acid encoding a peptide or polypeptide of this invention is preferably in an expression vector that includes viral nucleic acid including, but not limited to, vaccinia virus, adenovirus, retrovirus and/or adeno-associated virus nucleic acid. The nucleic acid or vector of this invention is optoinally in a liposome or a delivery vehicle which can be taken up by a cell via receptor-mediated or other type of endocytosis. The nucleic acid vaccines of this invention are preferably in a pharmaceutically acceptable carrier or administered with an adjuvant. The nucleic acids encoding the peptides and polypeptides of this invention can also be administered to cells in vivo or ex vivo.[0141] It is contemplated that the isolated nucleic acids of the disclosure are optionally "overexpressed", i.e., expressed in increased levels relative to its natural expression in cells of its indigenous organism, or even relative to the expression of other proteins in the recombinant host cell. Such overexpression is assessed by a variety of methods illustratively including radio-labeling and/or protein purification. However, simple and direct methods are preferred, for example, those involving SDS/PAGE and protein staining or immunoblotting, followed by quantitative analyses, such as densitometric scanning of the resultant gel or blot. A specific increase in the level of the recombinant protein or peptide in comparison to the level in natural in transfected cells is indicative of overexpression, as is a relative abundance of the specific protein in relation to the other proteins produced by the host cell and, e.g., visible on a gel.[0142] Various heterologous vectors are described for DNA vaccinations against viral infections. For example, the vectors described in the following references, incorporated herein by reference, may be used to express hEbola sequences instead of the sequences of the viruses or other pathogens described; in particular, vectors described for hepatitis B virus (Michel, M. L. et al., 1995, DAN-mediated immunization to the hepatitis B surface antigen in mice: Aspects of the humoral response mimic hepatitis B viral infection in humans, Proc. Natl. Aca. Sci.USA 92:5307-5311;Davis, H. L. et al., 1993, DNA-based immunization induces continuous secretion of hepatitis Bsurface antigen and high levels of circulating antibody, Human Molec. Genetics 2:1847-1851), HIVvirus (Wang, B. et al., 1993, Gene inoculation generates immune responses against human immunodeficiency virus type 1, Proc. Natl. Acad. Sci. USA 90:4156-4160; Lu, S.et al., 1996, Simian immunodeficiency virus DNA vaccine trial in Macques, J. Virol. 70:3978-3991; Letvin, N.L. et al., 1997, Potent, protective anti-HIV immune responses generated by bimodal HIV envelope DNA plus protein vaccination, Proc Natl Acad Sci USA. 94(17):9378-83), and influenza viruses (Robinson, H L et al., 1993, Protection against a lethal influenza virus challenge by immunization with a haemagglutinin-expressing plasmid DNA, Vaccine 11:957-960; Ulmer, J. B.et al., Heterologous protection against influenza by injection of DNA encoding a viral protein, Science 259:1745-1749), as well as bacterial infections, such as tuberculosis (Tascon, R. E. et al., 1996, Vaccination against tuberculosis by DNA injection, Nature Med. 2:888-892;Huygen, K. et al., 1996, Immunogenicity and protective efficacy of a tuberculosis DNA vaccine, Nature Med., 2:893-898), and parasitic infection, such as malaria (Sedegah, M., 1994, Protection against malaria by immunization with plasmid DNA encoding circumsporozoite protein, Proc. Natl.Acad. Sci. USA91:9866-9870; Doolan, D. L. et al., 1996, Circumventing genetic restriction of protection against malaria with multigene DNA immunization: CD8+T cell-interferon .delta., and nitric oxide-dependent immunity, J. Exper. Med., 1183:1739-1746).[0143] Many methods are optionally used to introduce the vaccine formulations described above. These include, but are not limited to, oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, and intranasal routes. Alternatively, in a preferred embodiment the chimeric virus vaccine formulation is introduced via the natural route of infection of the pathogen for which the vaccine is designed. The DNA vaccines of the present invention are optionally administered in saline solutions by injections into muscle or skin using a syringe and needle (Wolff J. A. et al., 1990, Direct gene transfer into mouse muscle in vivo, Science 247:1465-1468; Raz, E., 1994, Intradermal gene immunization: The possible role of DNA uptake in the induction of cellular immunity to viruses, c. Natl. Acd. Sci. USA 91:9519-9523). Another way to administer DNAvaccines operable herein is called the "gene gun" method, whereby microscopic gold beads coated with the DNA molecules of interest is fired into cells (Tang, D. et al., 1992, Genetic immunization is a simple method for eliciting an immune response, Nature 356:152-154). For general reviews of the methods for DNA vaccines, see Robinson, H. L., 1999, DNA vaccines: basic mechanism and immune responses (Review), Int. J. Mol. Med. 4(5):549-555; Barber, B., 1997, Introduction:Emerging vaccine strategies, Seminars in Immunology 9(5):269-270; and Robinson, H. L. et al., 1997, DNA vaccines, Seminars in Immunology 9(5):271-283.
Attenuation of hEbola Virus or Variants Thereof [0144] The hEbola virus or variants thereof of the invention are optionally genetically engineered to exhibit an attenuated phenotype. In particular, the viruses of the invention exhibit an attenuated phenotype in a subject to which the virus is administered as a vaccine. Attenuation can be achieved by any method known to a skilled artisan. Without being bound by theory, the attenuated phenotype of the viruses of the invention is caused, e.g., by using a virus that naturally does not replicate well in an intended host species, for example, by reduced replication of the viral genome, by reduced ability of the virus to infect a host cell, or by reduced ability of the viral proteins to assemble to an infectious viral particle relative to the wild type species of the virus.[0145] The attenuated phenotypes of hEbola virus or variants thereof are optionally tested by any method known to the artisan. A candidate virus, for example, is optionally tested for its ability to infect a host or for the rate of replication in a cell culture system. In certain embodiments, growth curves at different temperatures are used to test the attenuated phenotype of the virus. For example, an attenuated virus is able to grow at 35 C, but not at 39 C or 40 C. In certain embodiments, different cell lines are used to evaluate the attenuated phenotype of the virus. For example, an attenuated virus may only be able to grow in monkey cell lines but not the human cell lines, or the achievable virus titers in different cell lines are different for the attenuated virus. In certain embodiments, viral replication in the respiratory tract of a small animal model, including but not limited to, hamsters, cotton rats, mice and guinea pigs, is used to evaluate the attenuated phenotypes of the virus. In other embodiments, the immune response induced by the virus, including but not limited to, the antibody titers (e.g., assayed by plaque reduction neutralization assay or ELISA) is used to evaluate the attenuated phenotypes of the virus. In a specific embodiment, the plaque reduction neutralization assay or ELISA is carried out at a low dose. In certain embodiments, the ability of the hEbola virus to elicit pathological symptoms in an animal model is tested. A reduced ability of the virus to elicit pathological symptoms in an animal model system is indicative of its attenuated phenotype. In a specific embodiment, the candidate viruses are tested in a monkey model for nasal infection, indicated by mucus production.
[0146] The viruses of the invention are optionally attenuated such that one or more of the functional characteristics of the virus are impaired. In certain embodiments, attenuation is measured in comparison to the wild type species of the virus from which the attenuated virus is derived. In other embodiments, attenuation is determined by comparing the growth of an attenuated virus in 5 different host systems. Thus, for a non-limiting example, hEbola virus or a variant thereof is attenuated when grown in a human host if the growth of the hEbola or variant thereof in the human host is reduced compared to the non-attenuated hEbola or variant thereof.[0147] In certain embodiments, the attenuated virus of the invention is capable of infecting a host, is capable of replicating in a host such that infectious viral particles are produced. In 10 comparison to the wild type species, however, the attenuated species grows to lower titers or grows more slowly. Any technique known to the skilled artisan can be used to determine the growth curve of the attenuated virus and compare it to the growth curve of the wild type virus.[0148] In certain embodiments, the attenuated virus of the invention (e.g., a recombinant or chimeric hEbola) cannot replicate in human cells as well as the wild type virus (e.g., wild type 15 hEbola) does. However, the attenuated virus can replicate well in a cell line that lacks interferon functions, such as Vero cells.[0149] In other embodiments, the attenuated virus of the invention is capable of infecting a host, of replicating in the host, and of causing proteins of the virus of the invention to be inserted into the cytoplasmic membrane, but the attenuated virus does not cause the host to produce new infectious 20 viral particles. In certain embodiments, the attenuated virus infects the host, replicates in the host, and causes viral proteins to be inserted in the cytoplasmic membrane of the host with the same efficiency as the wild type hEbola. In other embodiments, the ability of the attenuated virus to cause viral proteins to be inserted into the cytoplasmic membrane into the host cell is reduced compared to the wild type virus. In certain embodiments, the ability of the attenuated hEbola virus to replicate in 25 the host is reduced compared to the wild type virus. Any technique known to the skilled artisan can be used to determine whether a virus is capable of infecting a mammalian cell, of replicating within the host, and of causing viral proteins to be inserted into the cytoplasmic membrane of the host.[0150] In certain embodiments, the attenuated virus of the invention is capable of infecting a host. In contrast to the wild type hEbola, however, the attenuated hEbola cannot be replicated in the 30 host. In a specific embodiment, the attenuated hEbola virus can infect a host and can cause the host to insert viral proteins in its cytoplasmic membranes, but the attenuated virus is incapable of being replicated in the host. Any method known to the skilled artisan can be used to test whether the attenuated hEbola has infected the host and has caused the host to insert viral proteins in its cytoplasmic membranes.[0151] In certain embodiments, the ability of the attenuated virus to infect a host is reduced compared to the ability of the wild type virus to infect the same host. Any technique known to the skilled artisan can be used to determine whether a virus is capable of infecting a host.[0152] In certain embodiments, mutations (e.g., missense mutations) are introduced into the genome of the virus, for example, into the sequence of SEQ ID NOs: 1 or 10, or to generate a virus with an attenuated phenotype. Mutations (e.g., missense mutations) can be introduced into the structural genes and/or regulatory genes of the hEbola. Mutations are optionally additions, substitutions, deletions, or combinations thereof. Such variant of hEbola can be screened for a predicted functionality, such as infectivity, replication ability, protein synthesis ability, assembling ability, as well as cytopathic effect in cell cultures. In a specific embodiment, the missense mutation is a cold-sensitive mutation. In another embodiment, the missense mutation is a heat-sensitive mutation. In another embodiment, the missense mutation prevents a normal processing or cleavage of the viral proteins.[0153] In other embodiments, deletions are introduced into the genome of the hEbola virus, which result in the attenuation of the virus.[0154] In certain embodiments, attenuation of the virus is achieved by replacing a gene of the wild type virus with a gene of a virus of a different species, of a different subgroup, or of a different variant. In another aspect, attenuation of the virus is achieved by replacing one or more specific domains of a protein of the wild type virus with domains derived from the corresponding protein of a virus of a different species. In certain other embodiments, attenuation of the virus is achieved by deleting one or more specific domains of a protein of the wild type virus.[0155] When a live attenuated vaccine is used, its safety should also be considered. The vaccine preferably does not cause disease. Any techniques known in the art for improving vaccine safety are operable in the present invention. In addition to attenuation techniques, other techniques are optionally be used. One non-limiting example is to use a soluble heterologous gene that cannot be incorporated into the virion membrane. For example, a single copy of the soluble version of a viral transmembrane protein lacking the transmembrane and cytosolic domains thereof is used.[0156] Various assays are optionally used to test the safety of a vaccine. For example, sucrose gradients and neutralization assays are used to test the safety. A sucrose gradient assay is optionally used to determine whether a heterologous protein is inserted in a virion. If the heterologous protein is inserted in the virion, the virion is preferably tested for its ability to cause symptoms in an appropriate animal model since the virus may have acquired new, possibly pathological, properties.5.4 Adjuvants and Carrier Molecules [0157] hEbola-associated antigens are administered with one or more adjuvants.In one embodiment, the hEbola-associated antigen is administered together with a mineral salt adjuvants or mineral salt gel adjuvant. Such mineral salt and mineral salt gel adjuvants include, but are not limited to, aluminum hydroxide (ALHYDROGEL, REHYDRAGEL), aluminum phosphate gel, aluminum hydroxyphosphate (ADJU-PHOS), and calcium phosphate.[0158] In another embodiment, hEbola-associated antigen is administered with an immunostimulatory adjuvant. Such class of adjuvants include, but are not limited to, cytokines (e.g., interleukin-2, interleukin-7, interleukin-12, granulocyte-macrophage colony stimulating factor (GM-CSF), interferon-y interleukin-1(3 (IL-1 (3), and IL-1 0 peptide or Sclavo Peptide), cytokine-containing liposomes, triterpenoid glycosides or saponins (e.g., QuilA and QS-21, also sold under the trademark STIMULON, ISCOPREP), Muramyl Dipeptide (MDP) derivatives, such as N-acetyl-muramyl-L-threonyl-D-isoglutamine (Threonyl-MDP, sold under the trademark TERMURTIDE), GMDP, N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine, N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-s- n-glycero-3-hydroxy phosphoryloxy)-ethylamine, muramyl tripeptide phosphatidylethanolamine (MTP-PE), unmethylated CpGdinucleotides and oligonucleotides, such as bacterial DNA and fragments thereof, LPS, monophosphoryl Lipid A (3D-MLA sold under the trademark MPL), and polyphosphazenes.[0159] In another embodiment, the adjuvant used is a particular adjuvant, including, but not limited to, emulsions, e.g., Freund's Complete Adjuvant, Freund's Incomplete Adjuvant, squalene or squalane oil-in-water adjuvant formulations, such as SAF and MF59, e.g., prepared with block-copolymers, such as L-121 (polyoxypropylene/polyoxyetheylene) sold under the trademark PLURONIC L-121, Liposomes, Virosomes, cochleates, and immune stimulating complex, which is sold under the trademark ISCOM.[0160] In another embodiment, a microparticular adjuvant is used.Microparticular adjuvants include, but are not limited to, biodegradable and biocompatible polyesters, homo- and copolymers of lactic acid (PLA) and glycolic acid (PGA), poly(lactide-co-glycolides) (PLGA) microparticles, polymers that self-associate into particulates (poloxamer particles), soluble polymers (polyphosphazenes), and virus-like particles (VLPs) such as recombinant protein particulates, e.g., hepatitis B surface antigen (HbsAg).
[0161] Yet another class of adjuvants that are optionally used include mucosal adjuvants, including but not limited to heat-labile enterotoxin from Escherichia coli (LT), cholera holotoxin (CT) and cholera Toxin B Subunit (CTB) from Vibrio cholerae, mutant toxins (e.g., LTK63 and LTR72), microparticles, and polymerized liposomes.[0162] In other embodiments, any of the above classes of adjuvants are optionally used in combination with each other or with other adjuvants. For example, non-limiting examples of combination adjuvant preparations used to administer the hEbola-associated antigens of the invention include liposomes containing immunostimulatory protein, cytokines, T-cell and/or B-cell peptides, or microbes with or without entrapped IL-2 or microparticles containing enterotoxin.Other adjuvants known in the art are also included within the scope of the invention (see Vaccine Design: The Subunit and Adjuvant Approach, Chap. 7, Michael F. Powell and Mark J. Newman (eds.), Plenum Press, New York, 1995, which is incorporated herein in its entirety).[0163] The effectiveness of an adjuvant is illustratively determined by measuring the induction of antibodies directed against an immunogenic polypeptide containing a hEbola polypeptide epitope, the antibodies resulting from administration of this polypeptide in vaccines which are also comprised of the various adjuvants.[0164] The polypeptides are optionally formulated into the vaccine as neutral or salt forms.Pharmaceutically acceptable salts include the acid additional salts (formed with free amino groups of the peptide) and which are formed with inorganic acids, such as, for example, hydrochloric or phosphoric acids, or organic acids such as acetic, oxalic, tartaric, maleic, and the like. Salts formed with free carboxyl groups are optionally derived from inorganic bases, such as, for example, sodium potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like.[0165] The vaccines of the invention are preferably multivalent or univalent.Multivalent vaccines are made from recombinant viruses that direct the expression of more than one antigen.[0166] Many methods are operable herein to introduce the vaccine formulations of the invention; these include but are not limited to oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal routes, and via scarification (scratching through the top layers of skin, e.g., using a bifurcated needle).[0167] The patient to which the vaccine is administered is preferably a mammal, most preferably a human, but is also optionally a non-human animal including but not limited to lower primates, cows, horses, sheep, pigs, fowl (e.g., chickens), goats, cats, dogs, hamsters, mice and rats.
Preparation of Antibodies [0168] Antibodies that specifically recognize a polypeptide of the invention, such as, but not limited to, polypeptides including the sequence of SEQ ID NOs: 2-9, 59, or 11-19 and other polypeptides as described herein, or hEbola epitope or antigen-binding fragments thereof are used in a preferred embodiment for detecting, screening, and isolating the polypeptide of the invention or fragments thereof, or similar sequences that might encode similar enzymes from the other organisms. For example, in one specific embodiment, an antibody which immunospecifically binds hEbola epitope, or a fragment thereof, is used for various in vitro detection assays, including enzyme-linked immunosorbent assays (ELISA), radioimmunoassays, western blot, etc., for the detection of a polypeptide of the invention or, preferably, hEbola, in samples, for example, a biological material, including cells, cell culture media (e.g., bacterial cell culture media, mammalian cell culture media, insect cell culture media, yeast cell culture media, etc.), blood, plasma, serum, tissues, sputum, naseopharyngeal aspirates, etc.[0169] Antibodies specific for a polypeptide of the invention or any epitope of hEbola are optionally generated by any suitable method known in the art. Polyclonal antibodies to an antigen of interest, for example, the hEbola virus from Deposit Accession No. 200706291, or including a nucleotide sequence of SEQ ID NOs: 1 or 10, are optionally produced by various procedures well known in the art. For example, an antigen is optionally administered to various host animals including, but not limited to, rabbits, mice, rats, etc., to induce the production of antisera containing polyclonal antibodies specific for the antigen. Various adjuvants are optionally used to increase the immunological response, depending on the host species, and include but are not limited to, Freund's (complete and incomplete) adjuvant, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful adjuvants for humans such as BCG (Bacille Calmette-Guerin) and Corynebacterium parvum. Such adjuvants are also well known in the art.[0170] Monoclonal antibodies are optionally prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. In one example, monoclonal antibodies are produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: ALaboratory Manual (Cold Spring Harbor Laboratory Press, 2nd ed. 1988);Hammerling, et al., in:Monoclonal Antibodies and T-Cell Hybridomas, pp. 563-681 (Elsevier, N.Y., 1981) (both of which are incorporated by reference in their entireties). The term "monoclonal antibody" as used herein is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody"refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.5 [0171] Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in the art. In a non-limiting example, mice are immunized with an antigen of interest or a cell expressing such an antigen. Once an immune response is detected, e.g., antibodies specific for the antigen are detected in the mouse serum, the mouse spleen is harvested and splenocytes isolated. The splenocytes are then fused by well known techniques to 10 any suitable myeloma cells. Hybridomas are selected and cloned by limiting dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding the antigen. Ascites fluid, which generally contains high levels of antibodies, is optionally generated by inoculating mice intraperitoneally with positive hybridoma clones.[0172] Antibody fragments which recognize specific epitopes are optionally generated by 15 known techniques. For example, Fab and F(ab')2 fragments are illustratively produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments). F(ab')2 fragments preferably contain the complete light chain, and the variable region, the CH1 region and the hinge region of the heavy chain.[0173] The antibodies of the invention or fragments thereof are optionally produced by any 20 method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques.[0174] The nucleotide sequence encoding an antibody is obtained from any information available to those skilled in the art (i.e., from Genbank, the literature, or by routine cloning and sequence analysis). If a clone containing a nucleic acid encoding a particular antibody or an epitope-25 binding fragment thereof is not available, but the sequence of the antibody molecule or epitope-binding fragment thereof is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNAlibrary, or a cDNA library generated from, or nucleic acid, preferably poly A+RNA, isolated from any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody) by PCRamplification using 30 synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR are optionally then cloned into replicable cloning vectors using any method known in the art.[0175] Once the nucleotide sequence of the antibody is determined, the nucleotide sequence of the antibody is optionally manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., supra;, and Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both incorporated by reference herein in their entireties), to generate antibodies having a different amino acid sequence by, for example, introducing amino acid substitutions, deletions, and/or insertions into the epitope-binding domain regions of the antibodies or any portion of antibodies which may enhance or reduce biological activities of the antibodies.[0176] Recombinant expression of an antibody requires construction of an expression vector containing a nucleotide sequence that encodes the antibody. Once a nucleotide sequence encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof has been obtained, the vector for the production of the antibody molecule is optionally produced by recombinant DNAtechnology using techniques known in the art as discussed in the previous sections. Methods which are known to those skilled in the art are optionally used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. The nucleotide sequence encoding the heavy-chain variable region, light-chain variable region, both the heavy-chain and light-chain variable regions, an epitope-binding fragment of the heavy- and/or light-chain variable region, or one or more complementarity determining regions (CDRs) of an antibody are optionally cloned into such a vector for expression.Thus, prepared expression vector is optionally then introduced into appropriate host cells for the expression of the antibody. Accordingly, the invention includes host cells containing a polynucleotide encoding an antibody specific for the polypeptides of the invention or fragments thereof.[0177] The host cell is optionally co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors illustratively contain identical selectable markers which enable equal expression of heavy and light chain polypeptides or different selectable markers to ensure maintenance of both plasmids. Alternatively, a single vector is optionally used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature, 322:52, 1986; and Kohler, Proc. Natl. Acad. Sci. USA, 77:2 197, 1980). The coding sequences for the heavy and light chains optionally include cDNA or genomic DNA.[0178] In another embodiment, antibodies are generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In a particular embodiment, such phage is utilized to display antigen binding domains, such as Fab and Fv or disulfide-bond stabilized Fv, expressed from a repertoire or combinatorial antibody library (e.g., human or murine). Phage expressing an antigen binding domain that binds the antigen of interest is optionally selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Phages used in these methods are typically filamentous phage, including fd and M13. The antigen binding domains are expressed as a recombinantly fused protein to either the phage gene III or gene VIII protein. Examples of phage display methods that can be used to make the immunoglobulins, or fragments thereof, of the present invention include those disclosed in Brinkman et al., J. Immunol. Methods, 182:41-50, 1995; Ames et al., J. Immunol.Methods, 184:177-186, 1995; Kettleborough et al., Eur. J. Immunol., 24:952-958, 1994; Persic et al., Gene, 187:9-18, 1997; Burton et al., Advances in Immunology, 57:191-280, 1994;PCT application No. PCT/GB91/01134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Pat. Nos. 5,698,426;5,223,409;5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908;5,516,637;5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is incorporated herein by reference in its entirety.[0179] As described in the above references, after phage selection, the antibody coding regions from the phage is optionally isolated and used to generate whole antibodies, including human antibodies, or any other desired fragments, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below. For example, techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments are optionally employed using methods known in the art such as those disclosed in PCT publication WO92/22324; Mullinax et al., BioTechniques, 12(6):864-869, 1992; and Sawai et al., AJRI, 34:26-34, 1995;and Better et al., Science, 240:1041-1043, 1988 (each of which is incorporated by reference in its entirety). Examples of techniques operable to produce single-chain Fvs and antibodies include those described in U.S.
Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in Enzymology, 203:46-88, 1991; Shu et al., PNAS, 90:7995-7999, 1993; and Skerra et al., Science, 240:1038-1040, 1988.[0180] Once an antibody molecule of the invention has been produced by any methods described above, or otherwise known in the art, it is then optionally purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A or Protein Gpurification, and sizing column chromatography), centrifligation, differential solubility, or by any other standard technique(s) for the purification of proteins. Further, the antibodies of the present invention or fragments thereof are optionally fused to heterologous polypeptide sequences described herein or otherwise known in the art to facilitate purification. Illustrative examples include 6xHis tag, FLAG tag, biotin, avidin, or other system.[0181] For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it is preferable to use chimeric, humanized, or human antibodies. Achimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a constant region derived from a human immunoglobulin. Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, Science, 229:1202, 1985; Oi et al., BioTechniques, 4:214 1986; Gillies et al., J. Immunol. Methods, 125:191-202, 1989; U.S. Pat. Nos.5,807,715; 4,816,567;and 4,816,397, which are incorporated herein by reference in their entireties.Humanized antibodies are antibody molecules from non-human species that bind the desired antigen having one or more complementarity determining regions (CDRs) from the non-human species and framework regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. See, e.g., Queen et al., U.S. Pat. No. 5,585,089;Riechmann et al., Nature, 332:323, 1988, which are incorporated herein by reference in their entireties. Antibodies are humanized using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Pat. Nos.5,225,539;5,530,101 and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596;Padlan, Molecular Immunology, 28(4/5):489-498, 1991; Studnicka et al., Protein Engineering, 7(6):805-814, 1994;
Roguska et al., Proc Natl. Acad. Sci. USA, 91:969-973, 1994), and chain shuffling (U.S. Pat. No.5,565,332), all of which are hereby incorporated by reference in their entireties.[0182] Completely human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies are made by a variety of methods known in the art illustratively including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCTpublications WO98/46645; WO 98/50433; WO 98/24893; WO 98/16654; WO 96/34096; WO 96/33735; and WO91/10741, each of which is incorporated herein by reference in its entirety.[0183] Human antibodies are also illustratively produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes. For an overview of this technology for producing human antibodies, see Lonberg and Huszar, Int. Rev. Immunol., 13:65-93, 1995. For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT publications WO 98/24893; WO92/01047; WO 96/34096;WO 96/33735; European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923;5,625,126; 5,633,425;5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; and 5,939,598, which are incorporated by reference herein in their entireties. In addition, companies such as Abgenix, Inc.(Fremont, Calif.), Medarex (NJ) and Genpharm (San Jose, Calif.) can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above.[0184] Completely human antibodies which recognize a selected epitope are optionally generated using a technique referred to as "guided selection." In this approach a selected non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope. (Jespers et al., Bio/technology, 12:899-903, 1988).[0185] Antibodies fused or conjugated to heterologous polypeptides are optionally used in in vitro immunoassays and in purification methods (e.g., affinity chromatography) known in the art.See e.g., PCT publication No. WO 93/21232; EP 439,095; Naramura et al., Immunol. Lett., 39:91-99, 1994; U.S. Pat. No. 5,474,981; Gillies et al., PNAS, 89:1428-1432, 1992;and Fell et al., J.Immunol., 146:2446-2452, 1991, which are incorporated herein by reference in their entireties.[0186] Antibodies may also be illustratively attached to solid supports, which are particularly useful for immunoassays or purification of the polypeptides of the invention or fragments, derivatives, analogs, or variants thereof, or similar molecules having the similar enzymatic activities as the polypeptide of the invention. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.
Pharmaceutical Compositions and Kits 5 [0187] The present invention encompasses pharmaceutical compositions including antiviral agents of the present invention. In a specific embodiment, the antiviral agent is preferably an antibody which immunospecifically binds and neutralizes the hEbola virus or variants thereof, or any proteins derived therefrom. In another specific embodiment, the antiviral agent is a polypeptide or nucleic acid molecule of the invention. The pharmaceutical compositions have utility as an 10 antiviral prophylactic agent are illustratively administered to a subject where the subject has been exposed or is expected to be exposed to a virus.[0188] Various delivery systems are known and operable to administer the pharmaceutical composition of the invention, illustratively, encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the mutant viruses, and receptor mediated 15 endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429 4432).Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compounds may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and optionally administered together 20 with other biologically active agents. Administration is systemic or local.In a preferred embodiment, it is desirable to introduce the pharmaceutical compositions of the invention into the lungs by any suitable route. Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.[0189] In a specific embodiment, it is desirable to administer the pharmaceutical compositions 25 of the invention locally to the area in need of treatment. This administration may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, by means of nasal spray, or by means of an implant, the implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. In one 30 embodiment, administration can be by direct injection at the site (or former site) infected tissues.[0190] In another embodiment, the pharmaceutical composition is delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez Berestein and Fidler (eds.), Liss, New York, pp.353-365 (1989); Lopez-Berestein, ibid. , pp. 317-327; see generally ibid.).[0191] In yet another embodiment, the pharmaceutical composition is delivered in a controlled release system. In one embodiment, a pump is used (see Langer, supra; Sefton, 1987, CRC Crit.Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507; and Saudek et al., 1989, N. Engl.J. Med. 321:574). In another embodiment, polymeric materials are used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla.(1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351;Howard et al., 1989, J.Neurosurg. 71:105). In yet another embodiment, a controlled release system is placed in proximity of the composition's target, i.e., the lung, thus, requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).[0192] Other controlled release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)) the contents of which are incorporated herein by reference.[0193] The pharmaceutical compositions of the present invention illustratively include a therapeutically effective amount of a live attenuated, inactivated or killed West African hEbola virus, or recombinant or chimeric hEbola virus, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.The term "carrier"refers to a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. Such pharmaceutical carriers are illustratively sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions are optionally employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, also contains wetting or emulsifying agents, or pH buffering agents. These compositions optionally take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained release formulations and the like. The composition is optionally formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation illustratively includes standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E. W. Martin. The formulation should suit the mode of administration.[0194] In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. The composition also includes an optional solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline is optionally provided so that the ingredients may be mixed prior to administration.[0195] The pharmaceutical compositions of the invention are illustratively formulated as neutral or salt forms. Pharmaceutically acceptable salts illustratively include those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2 ethylamino ethanol, histidine, procaine, etc.[0196] The amount of the pharmaceutical composition of the invention which will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. In addition, in vitro assays are optionally employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. However, suitable dosage ranges for intravenous administration are generally about 20 to 500 micrograms of active compound per kilogram body weight. Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body weight to 1 mg/kg body weight.
Effective doses may be extrapolated from dose response curves derived from in vitro or animal model test systems.[0197] Suppositories generally contain active ingredient in the range of 0.5%to 10% by weight;oral formulations preferably contain 10% to 95% active ingredient.[0198] The invention also provides a pharmaceutical pack or kit including one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Optionally associated with such container(s) is a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In a preferred embodiment, the kit contains an antiviral agent of the invention, e.g., an antibody specific for the polypeptides encoded by a nucleotide sequence of SEQ ID NOs: 1 or 10, or as shown in SEQ ID NOs: 2-9, 59, or 11-19, or any hEbola epitope, or a polypeptide or protein of the present invention, or a nucleic acid molecule of the invention, alone or in combination with adjuvants, antivirals, antibiotics, analgesic, bronchodilators, or other pharmaceutically acceptable excipients.[0199] The present invention further encompasses kits including a container containing a pharmaceutical composition of the present invention and instructions for use.
Detection Assays [0200] The present invention provides a method for detecting an antibody, which immunospecifically binds to the hEbola virus, in a biological sample, including for example blood, serum, plasma, saliva, urine, feces, etc., from a patient suffering from hEbola infection, and/or hemorrhagic fever. In a specific embodiment, the method including contacting the sample with the hEbola virus, for example, of Deposit Accession No. 200706291, or having a genomic nucleic acid sequence of SEQ ID NOs: 1 or 10, directly immobilized on a substrate and detecting the virus-bound antibody directly or indirectly by a labeled heterologous anti-isotype antibody. In another specific embodiment, the sample is contacted with a host cell which is infected by the hEbola virus, for example, of Deposit Accession No. 200706291, or having a genomic nucleic acid sequence of SEQID NOs: 1 or 10, and the bound antibody is optionally detected by immunofluorescent assay.[0201] An exemplary method for detecting the presence or absence of a polypeptide or nucleic acid of the invention in a biological sample involves obtaining a biological sample from various sources and contacting the sample with a compound or an agent capable of detecting an epitope or nucleic acid (e.g., mRNA, genomic DNA) of the hEbola virus such that the presence of the hEbola virus is detected in the sample. A preferred agent for detecting hEbola mRNAor genomic RNA of the invention is a labeled nucleic acid probe capable of hybridizing to mRNAor genomic RNAencoding a polypeptide of the invention. The nucleic acid probe is, for example, a nucleic acid molecule including the nucleotide sequence of SEQ ID NOs: 1 or 10, a complement thereof, or a portion thereof, such as an oligonucleotide of at least 15, 20, 25, 30, 50, 100, 250, 500, 750, 1000 or more contiguous nucleotides in length and sufficient to specifically hybridize under stringent conditions to a hEbola mRNA or genomic RNA.[0202] As used herein, the term "stringent conditions" describes conditions for hybridization and washing under which nucleotide sequences having at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity to each other typically remain hybridized to each other. Such hybridization conditions are described in, for example but not limited to, Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1 6.3.6.;Basic Methods in Molecular Biology, Elsevier Science Publishing Co., Inc., N.Y. (1986), pp.75 78, and 84 87; and Molecular Cloning, Cold Spring Harbor Laboratory, N.Y. (1982), pp.387 389, and are well known to those skilled in the art. A preferred, non-limiting example of stringent hybridization conditions is hybridization in 6x sodium chloride/sodium citrate (SSC), 0.5% SDS at about 68 C followed by one or more washes in 2xSSC, 0.5% SDS at room temperature. Another preferred, non-limiting example of stringent hybridization conditions is hybridization in 6x SSC at about 45 Cfollowed by one or more washes in 0.2x SSC, 0.1% SDS at 50 to 65 C.[0203] A nucleic acid probe, polynucleotide, oligonucleotide, or other nucleic acid is preferably purified. An "isolated" or "purified" nucleotide sequence is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the nucleotide is derived, or is substantially free of chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of a nucleotide/oligonucleotide in which the nucleotide/oligonucleotide is separated from cellular components of the cells from which it is isolated or produced. Thus, a nucleotide/oligonucleotide that is substantially free of cellular material includes preparations of the nucleotide having less than about 30%, 20%, 10%, 5%, 2.5%, or 1%, (by dry weight) of contaminating material. When nucleotide/oligonucleotide is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly, such preparations of the nucleotide/oligonucleotide have less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or compounds other than the nucleotide/oligonucleotide of interest.In a preferred embodiment of the present invention, the nucleotide/oligonucleotide is isolated or purified.[0204] In another preferred specific embodiment, the presence of hEbola virus is detected in the 5 sample by a reverse transcription polymerase chain reaction (RT-PCR) using the primers that are constructed based on a partial nucleotide sequence of the genome of hEbola virus, for example, that of Deposit Accession No. 200706291, or having a genomic nucleic acid sequence of SEQ ID NOs: 1 or 10. In a non-limiting specific embodiment, preferred primers to be used in a RT-PCR method are the primers are described in detail herein.10 [0205] In more preferred specific embodiment, the present invention provides a real-time quantitative PCR assay to detect the presence of hEbola virus in a biological sample by subjecting the cDNA obtained by reverse transcription of the extracted total RNA from the sample to PCRreactions using the specific primers described in detail herein, and a fluorescence dye, such as SYBR Green I, which fluoresces when bound nonspecifically to double-stranded DNA. The 15 fluorescence signals from these reactions are captured at the end of extension steps as PCR product is generated over a range of the thermal cycles, thereby allowing the quantitative determination of the viral load in the sample based on an amplification plot.[0206] A preferred agent for detecting hEbola is an antibody that specifically binds a polypeptide of the invention or any hEbola epitope, preferably an antibody with a detectable label.20 Antibodies are illustratively polyclonal, or more preferably, monoclonal.An intact antibody, or a fragment thereof (e.g., Fab or F(ab')2) is operable herein.[0207] The term "labeled", with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, optionally via a linker, as well as indirect labeling of the probe or antibody by 25 reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it is detectable with fluorescently labeled streptavidin. The detection method of the invention is optionally used to detect mRNA, protein (or any epitope), or genomic RNA in a sample in vitro as well as in vivo. Exemplary in vitro techniques for detection of 30 mRNA include northern hybridizations, in situ hybridizations, RT-PCR, and RNase protection. In vitro techniques for detection of an epitope of hEbola illustratively include enzyme linked immunosorbent assays (ELISAs), western blots, immunoprecipitations and immunofluorescence. In vitro techniques for detection of genomic RNA include northern hybridizations, RT-PCT, and RNase protection. Furthermore, in vivo techniques for detection of hEbola include introducing into a subject organism a labeled antibody directed against the polypeptide. In one embodiment, the antibody is labeled with a radioactive marker whose presence and location in the subject organism is detected by standard imaging techniques, including autoradiography.[0208] In a specific embodiment, the methods further involve obtaining a control sample from a control subject, contacting the control sample with a compound or agent capable of detecting hEbola, e.g., a polypeptide of the invention or mRNA or genomic RNA encoding a polypeptide of the invention, such that the presence of hEbola or the polypeptide or mRNA or genomic RNAencoding the polypeptide is detected in the sample, and comparing the absence of hEbola or the polypeptide or mRNA or genomic RNA encoding the polypeptide in the control sample with the presence of hEbola, or the polypeptide or mRNA or genomic DNA encoding the polypeptide in the test sample.[0209] The invention also encompasses kits for detecting the presence of hEbola or a polypeptide or nucleic acid of the invention in a test sample. The kit illustratively includes a labeled compound or agent capable of detecting hEbola or the polypeptide or a nucleic acid molecule encoding the polypeptide in a test sample and, in certain embodiments, a means for determining the amount of the polypeptide or mRNA in the sample (e.g., an antibody which binds the polypeptide or an oligonucleotide probe which binds to DNA or mRNA encoding the polypeptide).Kits optionally include instructions for use.[0210] For antibody-based kits, the kit illustratively includes: (1) a first antibody (e.g., attached to a solid support) which binds to a polypeptide of the invention or hEbola epitope; and, optionally, (2) a second, different antibody which binds to either the polypeptide or the first antibody and is preferably conjugated to a detectable agent.[0211] For oligonucleotide-based kits, the kit illustratively includes: (1) an oligonucleotide, e.g., a detectably labeled oligonucleotide, which hybridizes to a nucleic acid sequence encoding a polypeptide of the invention or to a sequence within the hEbola genome; or (2) a pair of primers useful for amplifying a nucleic acid molecule containing an hEbola sequence.The kit optionally includes a buffering agent, a preservative, or a protein stabilizing agent.The kit optionally includes components necessary for detecting the detectable agent (e.g., an enzyme or a substrate). The kit optionally contains a control sample or a series of control samples which can be assayed and compared to the test sample contained. Each component of the kit is usually enclosed within an individual container and all of the various containers are within a single package along with instructions for use.
Screening Assays to Identify Antiviral Agents [0212] The invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to infect a host or a host cell. In certain embodiments, the invention provides methods for the identification of a compound that reduces the ability of hEbola virus to replicate in a host or a host cell. Any technique well known to the skilled artisan is illustratively used to screen for a compound useful to abolish or reduce the ability of hEbola virus to infect a host and/or to replicate in a host or a host cell.[0213] In certain embodiments, the invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to replicate in a mammal or a mammalian cell.More specifically, the invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to infect a mammal or a mammalian cell. In certain embodiments, the invention provides methods for the identification of a compound that inhibits the ability of hEbola virus to replicate in a mammalian cell. In a specific embodiment, the mammalian cell is a human cell.[0214] In another embodiment, a cell is contacted with a test compound and infected with the hEbola virus. In certain embodiments, a control culture is infected with the hEbola virus in the absence of a test compound. The cell is optionally contacted with a test compound before, concurrently with, or subsequent to the infection with the hEbola virus. In a specific embodiment, the cell is a mammalian cell. In an even more specific embodiment, the cell is a human cell. In certain embodiments, the cell is incubated with the test compound for at least 1 minute, at least 5 minutes, at least 15 minutes, at least 30 minutes, at least 1 hour, at least 2 hours, at least 5 hours, at least 12 hours, or at least 1 day. The titer of the virus is optionally measured at any time during the assay. In certain embodiments, a time course of viral growth in the culture is determined. If the viral growth is inhibited or reduced in the presence of the test compound, the test compound is identified as being effective in inhibiting or reducing the growth or infection of the hEbola virus. In a specific embodiment, the compound that inhibits or reduces the growth of the hEbola virus is tested for its ability to inhibit or reduce the growth rate of other viruses to test its specificity for the hEbola virus.
[0215] In one embodiment, a test compound is administered to a model animal and the model animal is infected with the hEbola virus. In certain embodiments, a control model animal is infected with the hEbola virus without the administration of a test compound. The test compound is optionally administered before, concurrently with, or subsequent to the infection with the hEbola virus. In a specific embodiment, the model animal is a mammal. In an even more specific embodiment, the model animal is, but is not limited to, a cotton rat, a mouse, or a monkey. The titer of the virus in the model animal is optionally measured at any time during the assay. In certain embodiments, a time course of viral growth in the culture is determined. If the viral growth is inhibited or reduced in the presence of the test compound, the test compound is identified as being effective in inhibiting or reducing the growth or infection of the hEbola virus. In a specific embodiment, the compound that inhibits or reduces the growth of the hEbola in the model animal is tested for its ability to inhibit or reduce the growth rate of other viruses to test its specificity for the hEbola virus.[0216] According to the method of the invention, a human or an animal is optionally treated for for EboBun or EboIC, other viral infection or bacterial infection by administering an effective amount of an inventive therapeutic composition. Preferably, a vaccine is administered prophylactically. An "effective amount" is an amount that will induce an immune response in a subject. Illustratively, an effective amount of the compositions of this invention ranges from nanogram/kg to milligram/kg amounts for young children and adults. Equivalent dosages for lighter or heavier body weights can readily be determined. The dose should be adjusted to suit the individual to whom the composition is administered and will vary with age, weight and metabolism of the individual. The exact amount of the composition required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the particular peptide or polypeptide used, its mode of administration and the like. An appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein. One skilled in the art will realize that dosages are best optimized by the practicing physician or veterinarian and methods for determining dose amounts and regimens and preparing dosage forms are described, for example, in Remington's Pharmaceutical Sciences, (Martin, E. W., ed., latest edition), Mack Publishing Co., Easton, PA. Preferably, a single administration is operable to induce an immune response.[0217] Methods involving conventional biological techniques are described herein. Such techniques are generally known in the art and are described in detail in methodology treatises such as Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; and Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992 (with periodic updates). Immunological methods (e.g., preparation of antigen-specific antibodies, immunoprecipitation, and immunoblotting) are described, e.g., in Current Protocols in Immunology, ed. Coligan et al., John Wiley & Sons, New York, 1991; and Methods of Immunological Analysis, ed. Masseyeff et al., John Wiley & Sons, New York, 1992.[0218] Embodiments of inventive compositions and methods are illustrated in the following detailed examples. These examples are provided for illustrative purposes and are not considered limitations on the scope of inventive compositions and methods.
EXAMPLESExample 1:
Newly discovered Ebola virus associated with hemorrhagic fever outbreak in Bundibugyo, Uganda [0219] In late November 2007 HF cases were reported in the townships of Bundibugyo and Kikyo in Bundibugyo District, Western Uganda (Figure 1A). These samples were assayed as described by Towner, JS, et al., PLoS Pathog, 2008 November; 4(11): e1000212, the contents of which are incorporated herein by reference for methods, results, reagents, and all other aspects of the publication. A total of 29 blood samples were initially collected from suspect cases and showed evidence of acute ebolavirus infection in eight specimens using a broadly reactive ebolavirus antigen capture assay known to cross-react with the different ebolavirus species and an IgM capture assay based on Zaire ebolavirus reagents (Table 1). These specimens were negative when initially tested with highly sensitive real-time RT-PCR assays specific for all known Zaire and Sudan ebolaviruses and marburgviruses. However, further evidence of acute ebolavirus infection was obtained using a traditionally less sensitive (relative to the real-time RT-PCR assays) but more broadly reactive filovirus L gene-specific RT-PCR assay (1 specimen) (Table 1). Sequence analysis of the PCRfragment (400 bp of the virus L gene) revealed the reason for the initial failure of the real-time RT-PCR assays, as the sequence was distinct from that of the 4 known species of ebolavirus, although distantly related to Cote d'Ivoire ebolavirus. In total, 9 of 29 specimens showed evidence of ebolavirus infection, and all tests were negative for marburgvirus (data not shown).
[0220] Approximately 70% of the virus genome was rapidly sequenced from total RNAextracted from a patient serum (#200706291) using a newly established metagenomics pyrosequencing method (454 Life Sciences) which involves successive rounds of random DNAamplification8. Using the newly derived draft sequence, a real-time RT-PCRassay specific for the 5 NP gene of this virus was quickly developed and evaluated. The assay was shown to have excellent sensitivity (Table 1), finding positive all the initial six samples that tested positive by either virus antigen capture (five specimens) or virus isolation assays (four specimens).The antigen-capture, IgM, IgG and newly designed real-time PCR assays were quickly transferred to the Uganda Virus Research Institute during the course of the outbreak to facilitate rapid identification and isolation of 10 Ebola cases in the affected area for efficient control of the outbreak. The outbreak continued through late December 2007, and resulted in 149 suspected cases and 37 deaths9.[0221] Table 1. Ebolavirus diagnostic results of initial 29 specimens obtained from Bundibugyo District with numerical specimen numbers assigned. RT-PCR refers to results obtained from conventional PCR using the broadly reactive Filo A/B primers 13. Ag, IgM, and IgG refer to 15 results from ELISA-based assaysio' 11 with Zaire ebolavirus reagents while virus isolation refers to culture attempts on Vero E6 cells12. Q-RT-PCR refers to results obtained using the optimized Bundibugyo ebolavirus specific real-time RT-PCR assay with cycle threshold (Ct) values of positive (Pos) samples indicated in the far right column. * Specimen #200706291 is the clinical sample from which prototype isolate #811250 was obtained.
Table 1 ................................................................................................................................................................................................... .Sample No. RT-PCR Arc Virus Isolation Q RT PCR Ct ......... .........200706288 neg neg neg neg neg neg 40 200706289 neg neg neg neg neg neg 40 200706290....:...... n eg......>....neg.......n eg.......n eg._............neg ............................ n eg.....................40.......200706291.......... Pos......:.... Pos.......n eg neg Pos ............................ Pos..................23.64...>200706292..........neg..........!?.eg.......!?...9.......11e9._............!?.eg ............. ..............neg.....................40.......!?.eg .............. .............. neg..............200706293........... eg...... ....!?.eg.......!?...9........ neg.....................40.......200706294 neg neg neg neg neg neg 40 .......................................................................................................................................... .........................................................200706295 neg neg neg neg neg neg 40 200706296 neg neg Pos Pos neg neg 40 200706297 neg neg Pos Pos neg neg 40 200706298 neg Pos Pos Pos neg Pos 34.83 200706299 neg neg Pos Pos neg neg 40 200706300............neg........... neg..... ne..... neg...............neg............................ neg.....................40 200706301 ne. neg ne neg neg ne. 40 .................................;...........................................;.......... ..................................................... ...................................200706302 neg Pos Pos neg neg Pos 35.01 ................................:.....................:....................................................................................................................:.....................200706303 neg neg neg neg neg neg 40 200706304 neg neg neg neg Pos Pos 38.18 200706305....:...... neg......>....neg.......neg.......ne9 _............neg ............................ neg.....................40.......>200706306..........neg......>....neg.......neg......ne9 _............neg ............................neg.....................40.......200706307..........neg......>....!?eg.......neg......ne9_ _............neg ............................neg.....................40.......200706320.... .......ND.......>....Pos.......neg.......neg. .............Pos Pos 30.24 ......................................... ..:..200706321 ND neg neg neg neg neg 40 .....................................................................................................................................................................................................200706322 ND neg neg neg neg neg 40 200706323 ND neg neg neg neg neg 40 200706324 ND neg neg neg neg neg 40 200706325 ND neg neg..... neg...... neg neg ..... 40 200706326 ND neg neg neg neg neg 40 200706327 ND Pos neg neg Pos Pos 34.41 200706328 ND neg...... neg......neg, neg ne9...... 40 [0222] The entire genome sequence of this virus was completed using a classic primer walking sequencing approach on RNA. The complete genome of the Eb ebolavirus was not available, so it too was derived by a similar combination of random primed pyrosequencing and primer walking approaches. Acquisition of these sequences allowed for the first time the phylogenetic analysis of the complete genomes of representatives of all known species of Ebola and Marburg viruses. The analysis revealed that the newly discovered virus differed from the four existing ebolavirus species (Figure 1), with approximately 32% nucleotide difference from even the closest relative, EboIC(Table 2). Similar complete genome divergence (35-45%) is seen between the previously characterized ebolavirus species.[0223] Table 2. Identity matrix based on comparisons of full-length genome sequences of Zaire ebolaviruses 1976 (Genbank accession number NC_002549) and 1995 (Genbank accession number AY354458), Sudan ebolavirus 2000 (Genbank accession number NC_006432), Cote d'Ivoire ebolavirus 1994 (SEQ ID NO: 10), Reston ebolavirus 1989 (Genbank accession number NC_004161), and Bundibugyo ebolavirus 2007 (SEQ ID NO: 1).Table 2 Zaire `95 Sudan `00 EboIC `94 EboBun `07 Reston `89 Zaire `76 .988 .577 .630 .632 .581 Zaire `95 .577 .631 .633 .581 Sudan `00 .577 .577 .609 EboIC `94 .683 .575 EboBun `07 .576 [0224] The material and information obtained from the discovery of the new unique virus EboBun and the realization that together with EboIC these viruses represent a Glade of Bundibungyo-Ivory Coast Ebola virus species is valuable, and makes possible the development of clinical, diagnostic and research tools directed to human hEbola infection.Material and Methods [0225] Ebolavirus detection and virus isolation. Several diagnostic techniques were used for each sample: (i) antigen capture, IgG, and IgM assays were performed as previously described" (ii) virus isolation attempts were performed on Vero E6 cells12 and monitored for 14 days; (iii) RNAwas extracted and tested for Zaire16 and Sudan ebolavirus and marburgvirus4 using real-time quantitative RT-PCR assays designed to detect all known species of each respective virus species the primers/probe for the Sudan ebolavirus assay were EboSudBMG 1(+) 5'-GCC ATGGIT TCA GGTTTG AG-3' (SEQ ID NO: 21), EboSudBMG 1(-) 5'-GGT IAC ATT GGG CAA CAA TTC A-3' (SEQ ID NO: 22) and Ebola Sudan BMG Probe 5'FAM-AC GGT GCA CAT TCT CCT TTT CTCGGA-BHQ1 (SEQ ID NO: 23)]; (iv) the conventional RT-PCR was performed with the filo A/Bprimer set as previously described16 using Superscript III (Invitrogen) according to the manufacturer's instructions. The specimen 200706291 was selected as the reference sample for further sequence analysis.[0226] Genome sequencing. Pyrosequencing was carried out utilizing the approach developed by 454 Life Sciences, and the method described by Cox-Foster et al. 8 Subsequent virus whole genome primer walking was performed as previously described17 but using the primers specific for Bundibugyo ebolavirus RT-PCR amplification. In total, the entire virus genome was amplified in six overlapping RT-PCR fragments (all primers listed 5' to 3'): fragment A(predicted size 2.7 kb) was amplified using forward-GTGAGACAAAGAATCATTCCTG (SEQ ID NO: 24) with reverse-CATCAATTGCTCAGAGATCCACC (SEQ ID NO: 25); fragment B (predicted size 3.0 kb) was amplified using forward-CCAACAACACTGCATGTAAGT (SEQ ID NO: 26) with reverse-AGGTCGCGTTAATCTTCATC (SEQ ID NO: 27); fragment C (predicted size 3.5 kb) was amplified using forward-GATGGTTGAGTTACTTTCCGG (SEQ ID NO: 28) with reverse-GTCTTGAGTCATCAATGCCC (SEQ ID NO: 29); fragment D (predicted size 3.1 kb) was amplified using forward-CCACCAGCACCAAAGGAC (SEQ ID NO: 30) with reverse-CTATCGGCAATGTAACTATTGG (SEQ ID NO: 31); fragment E (predicted size 3.4 kb) was amplified using forward-GCCGTTGTAGAGGACACAC (SEQ ID NO: 32) with reverse-CACATTAAATTGTTCTAACATGCAAG (SEQ ID NO: 33) and fragment F (predicted size 3.5 kb) was amplified using forward-CCTAGGTTATTTAGAAGGGACTA (SEQ ID NO: 34) with reverse-GGT AGA TGT ATT GAC AGC AAT ATC (SEQ ID NO: 35).[0227] The exact 5' and 3' ends of Bundibugyo ebolavirus were determined by 3' RACE from virus RNA extracted from virus infected Vero E6 cell monolayers using TriPure isolation reagent.RNAs were then polyadenylated in vitro using A-Plus poly(A) polymerase tailing kit (Epicenter Biotechnologies) following the manufacturer's instructions and then purified using an RNeasy kit (Qiagen) following standard protocols. Ten microliters of in vitro polyadenylated RNA were added as template in RT--PCR reactions, using SuperScript III One--Step R'I'-PCRsystem with Platinum Tack High Fidelity (Invitrogen) following the manufacturer's protocol. Two parallel RT-PCRreactions using the oligo(dT)-containing 3'RACf-AP primer (Invitrogen) mixed with I of 2 viral specific primers, Ebo-U 692(-) ACAAAAAGCTATCTGCACTAT (SEQ ID NO: 36) and Ebo-U18269(+) CTCAGAAGCAAAATTAATGG (SEQ ID NO: 37), generated -700 nt long fragments containing the 3' ends of either genomic and antigenomic RNAs. The resulting RT-PCR products were analyzed by agarose electrophoresis, and DNA bands of the correct sizes were purified using QlAquick Gel Extraction Kit (Qiagen) and sequenced using standard protocols (ABI).[0228] The nucleotide sequence of the Cote d'Ivoire ebolavirus (EboIC) isolate RNA was initially determined using the exact same pyrosequencing strategy as that used for Bundibugyo ebolavirus described above. This method generated sequence for approximately 70% of the entire genome. This draft sequence was then used to design a whole genome primer walking strategy for filling any gaps and confirming the initial sequence. The following Cote d'Ivoire ebolavirus-specific primers were used to generate RT-PCR fragments, designated A-F, as follows: Fragment A(predicted size 3.0 kb) was amplified using forward-GTGTGCGAATAACTATGAGGAAG(SEQ
ID NO: 38) and reverse-GTCTGTGCAATGTTGATGAAGG (SEQ ID NO: 39); Fragment B(predicted size 3.2 kb) was amplified using forward-CATGAAAACCACACTCAACAAC(SEQ IDNO: 40) and reverse-GTTGCCTTAATCTTCATCAAGTTC (SEQ ID NO: 41); Fragment C(predicted size 3.0 kb) was amplified using forward-GGCTATAATGAATTTCCTCCAG(SEQ IDNO: 42) and reverse-CAAGTGTATTTGTGGTCCTAGC (SEQ ID NO: 43); fragment D(predicted size 3.5 kb) was amplified using forward-GCTGGAATAGGAATCACAGG (SEQ ID NO: 44) and reverse-CGGTAGTCTACAGTTCTTTAG (SEQ ID NO: 45); fragment E (predicted size 4.0 kb) was amplified using forward-GACAAAGAGATTAGATTAGCTATAG (SEQ ID NO: 46) and reverse-GTAATGAGAAGGTGTCATTTGG (SEQ ID NO: 47); fragment F (predicted size 2.9 kb) was amplified using forward-CACGACTTAGTTGGACAATTGG (SEQ ID NO: 48) and reverse-CAGACACTAATTAGATCTGGAAG (SEQ ID NO: 49); fragment G (predicted size 1.3 kb) was amplified using forward-CGGACACACAAAAAGAAWRAA (SEQ ID NO: 50) and reverse-CGTTCTTGACCTTAGCAGTTC (SEQ ID NO: 51); and fragment H (predicted size 2.5 kb) was amplified using forward-GCACTATAAGCTCGATGAAGTC (SEQ ID NO: 52) and reverse-TGGACACACAAAAARGARAA (SEQ ID NO: 53). A gap in the sequence contig was located between fragments C and D and this was resolved using the following primers to generate a predicted fragment of 1.5 kb: forward-CTGAGAGGATCCAGAAGAAAG (SEQ ID NO: 54) and reverse-GTGTAAGCGTTGATATACCTCC (SEQ ID NO: 55). The terminal -20 nucleotides of the sequence were not experimentally determined but were inferred by comparing with the other known Ebola genome sequences.[0229] Bundibugyo ebolavirus real-time RT-PCR assay. The primers and probe used in the Bundibugyo ebolavirus specific Q-RT-PCR assay were as follows: EboU965( +): 5'-GAGAAAAGGCCTGTCTGGAGAA-3' (SEQ ID NO: 56), EboU1039(-): 5'-TCGGGTATTGAATCAGACCTTGTT-3' (SEQ ID NO: 57) and EboU989 Prb: 5'Fam-TTCAACGACAAATCCAAGTGCACGCA-3'BHQ1 (SEQ ID NO 58). Q-RT-PCR reactions were set up using Superscript III One-Step Q-RT-PCR (Invitrogen) according to the manufacturer's instructions and run for 40 cycles with a 58 C annealing temperature.[0230] Phylogenetic analysis. Modeltest 3.718 was used to examine 56 models of nucleotide substitution to determine the model most appropriate for the data. The General Time Reversible model incorporating invariant sites and a gamma distribution (GTR+I+G) was selected using the Akaike Information Criterion (AIC). Nucleotide frequencies were A = 0.3278, C= 0.2101, G =0.1832, T = 0.2789, the proportion of invariant sites = 0.1412, and the gamma shape parameter =
1.0593. A maximum likelihood analysis was subsequently performed in PAUP*4.ObIO19 using the GTR+I+G model parameters. Bootstrap support values were used to assess topological support and were calculated based on 1,000 pseudoreplicates20.[0231] In addition, a Bayesian phylogenetic analysis was conducted in MrBayes 3.221 using the 5 GTR+I+G model of nucleotide substitution. Two simultaneous analyses, each with four Markov chains, were run for 5,000,000 generations sampling every 100 generations.Prior to termination of the run, the AWTY module was used to assess Markov Chain Monte Carlo convergence to ensure that the length of the analysis was sufficient22. Trees generated before the stabilization of the likelihood scores were discarded (burn in = 40), and the remaining trees were used to construct a 10 consensus tree. Nodal support was assessed by posterior probability values (> 95 = statistical support).
Example 2 [0232] Immunization against EboBun:15 [0233] To determine the capability of immunogens to elict an immune response in non-human primates (NHP), 12 cynomolgus macaques, of which 10 are immunized with VSVAG/EboBunGPeither orally (OR; n = 4), intranasally (IN; n = 4) or intramuscularly (IM; n = 2) in accordance with all animal control and safety guidelines and essentially as described by Qiu, X, et al., PLoS ONE. 2009;4(5): e5547. The remaining 2 control animals are vaccinated intramuscularly with 20 VSVAG/MARVGP. VSVAG/MARVGP does not provide heterologous protection against EboBun, therefore these NHPs succumb to EboBun infection. Animals are acclimatized for 14 days prior to infection. Animals are fed and monitored twice daily (pre- and post-infection) and fed commercial monkey chow, treats and fruit. Husbandry enrichment consists of commercial toys and visual stimulation.25 [0234] The recombinant VSVAG/EboBun vaccines are synthesized expressing the EboBun glycoprotein (GP) (SEQ ID NO: 9), soluble glycoprotein (sGP) (SEQ ID NO: 4), or nucleoprotein (NP) (SEQ ID NO: 3). Control VSVAG/MARVGP vaccines represent the analogous proteins from Lake victoria marburgvirus (MARV) (strain Musoke). The following results for GP are similar for sGP and NP. Vaccines are generated using VSV (Indiana serotype) as described previously.30 Garbutt, M, et al., J Virol, 2004; 78(10):5458-5465; Schnell, MJ, et al., PNAS USA, 1996;93(21):11359-11365. EboBun challenge virus is passaged in Vero E6 cells prior to challenge, as described previously Jones, SM, et al., Nat Med, 2005; 11(7):786-790;Jahrling, PB, et al., J Infect Dis, 1999; 179(Suppl 1):S224-34. An EboBun immunogen peptide pool consisting of 15mers with 11 amino acid overlaps (Sigma-Genosys) spanning the entire sequence of the EboBun immunogens and strain Mayinga 1976 GP are used.[0235] Twelve filovirus naive cynomolgus monkeys randomized into four groups receive 2 ml of lx107 PFU/ml of vaccine in Dulbecco's modified Eagle's medium (DMEM).Animals in the three experimental groups are vaccinated with either: 1) 2 ml orally (OR) (n = 4);2) 1 ml dripped into each nostril, intranasally (IN) (n = 4); or 3) 1 ml each into two sites intramuscularly (IM) (n = 2).The two controls are injected intramuscularly with 2 ml of lx107 PFU/ml of VSVAG/MARVGP. All animals are challenged intramuscularly 28 days later with 1,000 PFU of EboBun.[0236] Routine examination is conducted on 0, 2, 4, 6, 10, 14 and 21 days post-vaccination, then 0, 3, 6, 10, 14, 19, 26 days, 6 and 9 months after the EboBun challenge.For the examinations animals are anaesthetized by intramuscular injection with 10 mg/kg of ketaset (Ayerst).Examinations include haematological analysis, monitoring temperature (rectal), respiration rate, lymph nodes, weight, hydration, discharges and mucous membranes. Also, swabs (throat, oral, nasal, rectal, vaginal) and blood samples are collected (4 ml from femoral vein, 1 ml in EDTA vacutainer tube; 3 ml in serum separator vacutainer tube). Cynomolgus monkey PBMCs are isolated using BDCPT sodium citrate Vacutainers (Becton Dickinson) as per manufacturer's protocol.[0237] All VSVAG/EboBunGP immunized animals are protected from high dose challenge.These animals show no evidence of clinical illness after vaccination or EboBun challenge. Both control animals demonstrate typical symptoms associated with EboBun HFincluding fever, macular rashes, lethargy, and unresponsiveness. Continued infection requires euthanization. Hematology analyses at each examination date demonstrate increases in the platelet-crit in the OR and IN groups post-challenge, however, no significant changes are observed in any NHPs post-immunization or in the VSVAG/EboBunGP immunized NHPs post-challenge.[0238] EboBun antibody production from humoral antibody response to vaccination and challenge is examined by a virus like particle (VLP) based ELISA assay.Generation of EboBun VLPs is performed by the protocol for ZEBOV as described by Wahl-Jensen, V., et al., J Virol, 2005; 79(4):2413-2419. ELISA is performed by the protocol described by Qiu, X, et al., PLoS ONE.2009; 4(5): e5547.[0239] The VSVAG/MARVGP immunized animals do not develop a detectable antibody response to EboBun. In contrast, potent antibody responses are detected in all VSVAG/EboBunGPimmunized animals independent of immunization route. Between days 14 and 21 post-vaccination, all VSVAG/EboBunGP immunized NHPs develop high levels of IgA, IgM, and IgGagainst EboBunGP. After challenge the IgM titres do not exceed the post-vaccination levels, however, IgGand IgA antibody titres are increased peaking 14 days post-challenge then slowly decreasing before maintaining a relatively high antibody titre up to 9 months.[0240] The level of neutralization antibodies is detected by a EboBun-GFP flow cytometric neutralization assay in serum collected at days 0 and 21 post-vaccination.Samples are assayed in duplicate for their ability to neutralize an infection with EboBun-GFP in VeroE6 cells. Serially diluted serum samples are incubated with an equal volume of EboBun-GFP in DMEM, at 37 C, 5%CO2 for 1 hr followed by addition of 150 l per well of a confluent 12 well plate of VeroE6 cells (MOI = 0.0005). After 2 hours at 37 C, 5% C02, 1 ml of DMEM, 2% fetal bovine serym (FBS), 100 U/ml penicillin, 100 g/ml streptomycin is added per well and incubated for 5 days. Cells are harvested by removing the culture supernatant, washing with 1 ml PBS, 0.04%EDTA, then adding 800 l of PBS 0.04% EDTA for 5 minutes at 37 C before adding 8 ml PBS, 4%paraformaldehyde (PFA) and overnight incubation. The cells are acquired (10,000 events) and analyzed with CellQuest Pro v3.3 on a Becton Dickinson FACSCalibur flow cytometer.[0241] The OR and IN routes produce EboBunGP-specific neutralizing antibodies with the ORroute producing the highest titres post-vaccination. The IM immunization produces detectable levels of neutralizing antibody. In comparison, 3/4 NHPs in the OR group demonstrate a 50% reduction in EboBun-GFP positive cells at a titre of 1:40. Similarly, the IN route results in a reduction of EboBun-GFP positive cells at the 1:40 dilution.[0242] EboBunGP-specific effector cellular immune responses are determined using IL-2 and IFN-y ELISPOT assays as described by Qin, X, et al., PLoS ONE. 2009; 4(5):e5547 to determine the number of IL-2 and IFN-y secreting lymphocytes. Prior to challenge on days 10 to 14 post-vaccination there is a detectable EboBun immunogen-specific IFN-y response in all immunized animals. The IM route is the most potent, inducing approximately 2-fold more IFN-y secreting cells than OR (p
Population Growth Propaganda from Barcode producer
Adam, In The Morning!
After hearing yours and Johns interesting discussion on the scare of population explosion I thought you might be interested to hear about this non-profit group that contacted me not too long ago. I am a 7th grade social studies teacher. I sent you an email a while back about the barcoded scratch paper that our student were required to use during their PARCC testing. Well, in my school mail I got a letter from a non-profit group named Negative Population Growth, soliciting to me free resources to help me teach my students about the apocalyptic world they were going to be growing up in because of population growth. Of course, I responded right away and got every free resource they were offering! Their stuff is nothing but sensationalist bullcrap, but to an impressionable middle schooler it is the stuff of nightmares!
I tried looking up some of the members of their board, and I perused their form 990 but I didn’t find anything very interesting, they just seem like a small time group whose main purpose is to scare the shit out of kids so they will never even think about reproducing.
Hope this is helpful, keep fighting the good fight!
Donald Mann, PresidentDon graduated in June 1943 from Wesleyan University, Middletown, CT with a degree in liberal arts. He spent the next three years as an officer in the Navy amphibious forces in World War II.
After the war he pursued graduate studies, first at Columbia University (philosophy) and then at l'Institut d'Etudes Politiques (economics) in Paris. His business career was mainly in the international field, and led to long assignments in such countries as Lebanon, Morocco, Belgium, and France.
An ardent environmentalist for many years, in 1971 he came to realize that, strangely, there was no organization that even tried to adequately address the problem of overpopulation '' the root cause of our overwhelming environmental and resource problems. He was convinced that a new organization to address the problem was badly needed; therefore, with a great deal of help from many sources and individuals, he founded NPG, Inc. in 1972.
Craig Lewis, Executive Vice PresidentCraig joined NPG in 1999 and is responsible for the daily operations and program management of the organization, as well as oversight of our staff. His many years at NPG have exposed him to the many aspects of the field of population growth, allowing him to contribute valuable insight to our mission and direction. Craig holds degrees in History and International Studies from West Virginia University.
Tracy Canada, Deputy DirectorTracy joined NPG in 2012. Contributing to the structure and development of NPG's extensive publications programs, Tracy serves as the organization's primary editor and a contributing author. She also assists in the daily operations and programs at NPG. Tracy holds a degree in Leadership & Social Change from Virginia Tech, with a professional background in non-profit and program management.
Frances Dorner
Josephine Lobretto
Donald Mann
Sharon Marks
Diane Saco
Theresa Mickendrow, Assistant to the PresidentTheresa joined NPG in 1993. Beyond her role as assistant to our president, Theresa also manages NPG's advertising program and orchestrates much of our annual scholarship program. Her work consistently advances the NPG message and aids us in our mission to slow, halt, and eventually reverse U.S. population growth.
Chris Miller, Membership Services AssistantChris joined NPG in 2010, providing administrative support to our membership and publications programs. His knowledge of our organization's educational materials has proven invaluable to NPG members and staff. He is currently pursuing his undergraduate degree from George Mason University. Chris also served in the U.S. military and has a strong leadership background.
Deborah Miller, Webmaster and Research AssistantDeborah joined NPG in 2005. She maintains and updates NPG's website and social media pages, as well as providing valuable research assistance to our Executive staff. Prior to coming to NPG, she studied communications at the University of Southern Maine and lived in New York City to pursue a career in the music industry. Deborah has extensive IT knowledge, and her technological savvy keeps our organization's online presence up-to-date and running smoothly.
Susan Samuels, Administrative AssistantSusan joined NPG in 2013. She is responsible for guiding phone inquiries to appropriate staff, as well as providing administrative support to our various programs. Susan holds multiple degrees '-- an A.A. in Human Services from Cazenovia College, a B.A. in Business Management from Potomac College, and a M.A. in Human Resource Development from George Washington University. Susan's extensive educational background and professional experience in non-profits make her a valuable addition to our organization.
NPG ' 2861 Duke Street, Suite 36 ' Alexandria, VA 22314 ' 703-370-9510Negative Population Growth (C) 2014. All Rights Reserved.
John Paul Holdren (born March 1, 1944) is the senior advisor to President Barack Obama on science and technology issues through his roles as Assistant to the President for Science and Technology, Director of the White House Office of Science and Technology Policy, and Co-Chair of the President's Council of Advisors on Science and Technology (PCAST)[2][3][4][5][6][7]
Holdren was previously the Teresa and John Heinz Professor of Environmental Policy at the Kennedy School of Government at Harvard University,[8] director of the Science, Technology, and Public Policy Program at the School's Belfer Center for Science and International Affairs, and Director of the Woods Hole Research Center.[9]
Biography[edit]Holdren was born in Sewickley, Pennsylvania, and grew up in San Mateo, California.[10] He trained in aeronautics, astronautics and plasma physics and earned a bachelor's degree from the Massachusetts Institute of Technology in 1965 and a Ph.D. from Stanford University in 1970 supervised by Oscar Buneman.[1][11] He taught at Harvard for 13 years and at the University of California, Berkeley for more than two decades.[2] His work has focused on the causes and consequences of global environmental change, energy technologies and policies, ways to reduce the dangers from nuclear weapons and materials, and science and technology policy.[2][9] He has also taken measures to contextualize the U.S.'s current energy challenge, noting the role that nuclear energy could play.[12] In 2008, he lived in Falmouth, Massachusetts, with his wife, biologist Cheryl E. Holdren, with whom he has two children and five grandchildren.[10]
Holdren was involved in the famous Simon''Ehrlich wager in 1980. He, along with two other scientists helped Paul R. Ehrlich establish the bet with Julian Simon, in which they bet that the price of five key metals would be higher in 1990. The bet was centred around a disagreement concerning the future scarcity of resources in an increasingly polluted and heavily populated world. Ehrlich and Holdren lost the bet, when the price of metals had decreased by 1990.[13]
Holdren was chair of the Executive Committee of the Pugwash Conferences on Science and World Affairs from 1987 until 1997 and delivered the Nobel Peace Prize acceptance lecture on behalf of Pugwash Conferences in December 1995. From 1993 until 2003, he was chair of the Committee on International Security and Arms Control of the National Academy of Sciences, and Co-Chairman of the bipartisan National Committee on Energy Policy from 2002 until 2007. Holdren was elected President of the American Association for the Advancement of Science (AAAS) (2006''2007), and served as board Chairman (2007''2008).[9] He was the founding chair of the advisory board for Innovations, a quarterly journal about entrepreneurial solutions to global challenges published by MIT Press, and has written and lectured extensively on the topic of global warming.
Holdren served as one of President Bill Clinton's science advisors (PCAST) from 1994 to 2001.[2] Eight years later, President Barack Obama nominated Holdren for his current position as science advisor and Director of the Office of Science and Technology Policy in December 2008, and he was confirmed on March 19, 2009, by a unanimous vote in the Senate.[14][15][16][17] He testified to the nomination committee that he does not believe that government should have a role in determining optimal population size[18] and that he never endorsed forced sterilization.[19][20][21]
Recent publications[edit]Holdren is the author of over 200 articles and papers, and he has co-authored and co-edited some 20 books and book-length reports, including:[22]
Science in the White House.Science, May 2009, 567.[3]Policy for Energy Technology Innovation. Acting in Time on Energy Policy, (with Laura Diaz Anadon, Max H. Bazerman, David T. Ellwood, Kelly Sims Gallagher, William H. Hogan, Henry Lee, and Daniel Schrag), Brookings Institution Press, 2009.The Future of Climate Change Policy: The U.S.'s Last Chance to Lead.Scientific American 2008 Earth 3.0 Supplement. October 13, 2008, 20-21.[23]Convincing the Climate Change Skeptics.Boston Globe, August 4, 2008.[24]Ending the Energy Stalemate: A Bipartisan Strategy To Meet America's Energy Challenges. Presentation at the National Academies 2008 Energy Summit, Washington, D.C., March 14, 2008.[25]Global Climatic Disruption: Risks and Opportunities. Presentation at Investor Summit on Climate Risk, New York, February 14, 2008.[26]Meeting the Climate-Change Challenge. The John H. Chafee Memorial Lecture, National Council for Science and the Environment, Washington, D.C., January 17, 2008.[27]Early publications[edit]Overpopulation was an early concern and interest. In a 1969 article, Holdren and co-author Paul R. Ehrlich argued, "if the population control measures are not initiated immediately, and effectively, all the technology man can bring to bear will not fend off the misery to come."[28] In 1973, Holdren encouraged a decline in fertility to well below replacement in the United States, because "210 million now is too many and 280 million in 2040 is likely to be much too many."[29] In 1977, Paul R. Ehrlich, Anne H. Ehrlich, and Holdren co-authored the textbook Ecoscience: Population, Resources, Environment; they discussed the possible role of a wide variety of means to address overpopulation.[20][30][31]
Other early publications include Energy (1971), Human Ecology (1973), Energy in Transition (1980), Earth and the Human Future (1986), Strategic Defenses and the Future of the Arms Race (1987), Building Global Security Through Cooperation (1990), and Conversion of Military R&D (1998).[22]
References[edit]^ abHoldren, John Paul (1970). Collisionless Stability of an Inhomogeneous, Confied, Planar Plasma (PhD thesis). Stanford University. ^ abcdProfile: John Holdren "Why He Matters","WhoRunsGov.com", A Washington Post Co Pub. accessed July 24, 2009.^ abHoldren, J. P. (2009). "Science in the White House". Science324 (5927): 567. doi:10.1126/science.1174783. PMID 19407163. edit^Mervis, J. (2009). "NEWSMAKER INTERVIEW: John Holdren Brings More Than Energy to His Role as Science Adviser". Science324 (5925): 324''325. doi:10.1126/science.324.5925.324. PMID 19372403. edit^Mervis, J. (2009). "OBAMA ADMINISTRATION: No News is Good News for Holdren, Lubchenco at Confirmation Hearing". Science323 (5917): 995. doi:10.1126/science.323.5917.995. PMID 19229004. edit^Tollefson, J. (2009). "John Holdren: Adviser on science, fish and wine". Nature457 (7232): 942''943. doi:10.1038/457942b. PMID 19225485. edit^Kintisch, E.; Mervis, J. (2009). "THE TRANSITION: Holdren Named Science Adviser, Varmus, Lander to Co-Chair PCAST". Science323 (5910): 22''23. doi:10.1126/science.323.5910.22. PMID 19119188. edit^John Holdren from the Scopus bibliographic database^ abcNews release. "Obama to Name John P. Holdren as Science Adviser" AAAS, December 18, 2008.^ abWilke, Sharon; Sasha Talcott (20 December 2008). "Harvard Kennedy School's John P. Holdren Named Obama's Science Advisor". Press release. Belfer Center for Science and International Affairs. Retrieved 2009-10-20. ^John Holdren at the Mathematics Genealogy Project^http://alum.mit.edu/pages/sliceofmit/2010/10/26/science-advisor-john-holdren-%e2%80%9965-sm-%e2%80%9966-contextualizes-energy-challenge/^Dan Gardner (2010). Future Babble: Why Expert Predictions Fail '' and Why We Believe Them Anyway. Toronto: McClelland and Stewart. p. 232. ^Staff and news service reports. "Obama's science adviser starts job", "msnbc.com", March 20, 2009.^Library of Congress [1], Nomination PN65-07-111, confirmed by Senate voice vote.^Nominations considered and confirmed en bloc, Congressional Record, March 19, 2009 S3577-S3578.^Koenig, Robert. "President Barack Obama's Director of the White House Office of Science and Technology Policy Faces Limited Criticism at Confirmation Hearings", Seed Magazine, February 13, 2009.^Video.[2] Senate Confirmation Hearing, February 12, 2009.^Pratt, Andrew Plemmons "Right-wing Attacks on Science Adviser Continue", Science Progress, July 21, 2009^ abMooney, Chris."Hold off on Holdren (again)", "Science Progress", July 2009.^Goldberg, Michelle. "Holdren's Controversial Population Control Past", The American Prospect, July 21, 2009, accessed July 30, 2009.^ ab"John P. Holdren's CV", The Woods Hole Research Center.^Holdren, John P."The Future of Climate Change Policy: The U.S.'s Last Chance to Lead", Scientific American^Holdren, John P. "Convincing the Climate Change Skeptics", the Boston Globe, August 4, 2008.^"Faculty page-Harvard University". ^Holdren, John P."Global Climatic Disruption: Risks and Opportunities", Presentation at Investor Summit on Climate Risk, New York, February 14, 2008.^Holdren, John P. "Meeting the Climate-Change Challenge.", The John H. Chafee Memorial Lecture, National Council for Science and the Environment, Washington, D.C., January 17, 2008.^Paul R. Erlich and John P. Holdren. "Population and Panaceas A Technological Perspective", Bioscience, Vol 19, pages 1065-1071, 1969.^Holdren, John P. (1973). "Population and the American Predicament: The Case Against Complacency". Daedalus, the No-Growth Society: 31''44. ISBN 978-0-7130-0136-5. ^Ehrlich, Paul R.; Anne H. Ehrlich and John P. Holdren (1977). Ecoscience: population, resources, environment. San Francisco: Freeman. ISBN 0-7167-0567-2. ^Farley, Robert; Montgomery, Scott (July 29, 2009). "Glenn Beck claims science czar John Holdren proposed forced abortions and putting sterilants in the drinking water to control population". Politifact. Retrieved 12 January 2014. ^"Fellows List: H". MacArthur Foundation. Retrieved June 3, 2011. ^"Book of Members, 1780''2010: Chapter H". American Academy of Arts and Sciences. Retrieved June 3, 2011. ^"Holdren, John P.". United States National Academy of Sciences. Retrieved June 3, 2011. ^"Dr. John P. Holdren". National Academy of Engineering. Retrieved June 3, 2011. ^The Heinz Awards, John Holdren profileExternal links[edit]Biography at the Office of Science and Technology PolicyJohn Holdren collected news and commentary at The Washington PostAppearances on C-SPANJohn Holdren collected news and commentary at The New York TimesWorks by or about John Holdren in libraries (WorldCat catalog)John Holdren at Harvard Kennedy School's Belfer Center for Science and International AffairsHoldren's Faculty page at Harvard UniversityHoldren's CV at Woods Hole Research CenterPresidential Address: Science and Technology for Sustainable Well-Being in Science (journal) 25.January.2008 Vol. 319. no. 5862, pp. 424 '' 434"Interview on Late Night with David Letterman", "CBS.com", April 17, 2008."Nominations Hearing for Director OSTP", Washington DC, February 12, 2009.The New Team: John P. Holdren, profile at The New York TimesJohn Holdren Speech at the Harvard Kennedy School Forum "Global Climate Disruption: What do we know? What should we do?"Nobel Prize, Pugwash Online, Arms Limitation and Peace Building in the Post-Cold-War World presented by Professor John P. Holdren, Chairman, Pugwash Executive Committee, 10 December 1995, Oslo, NorwayLead essay for Innovations journal (Vol. 1, No. 2) "The Energy Innovation Imperative: Addressing Oil Dependence, Climate Change, and Other 21st Century Energy Challenges"John Holdren speaking at The American Response to Climate Change Conference, held at The Wild Center.Holdren Urged a 'World of Zero Net Physical Growth' in 1995 World Bank Publication.Office
Name
Term
Office
Name
Term
White House Chief of StaffWhite House Deputy Chief of Staff for Policy
Rahm EmanuelPete RouseWilliam M. DaleyJacob LewMona SutphenNancy-Ann DeParleRob Nabors2009''102010''112011''122012''2009''112011''132013''National Security AdvisorDeputy National Security Advisor
Jim JonesThomas E. DonilonSusan RiceThomas E. DonilonDenis McDonoughTony Blinken 2009''102010''132013''2009''102010''132013'' White House Deputy Chief of Staff for Operations White House Deputy Chief of Staff for PlanningSenior Advisor to the President Counselor to the PresidentJim MessinaAlyssa MastromonacoMark B. ChildressDavid AxelrodDavid PlouffePete Rouse2009''112011''2012''2009''112011''2009''Deputy National Security Advisor for Iraq and AfghanistanDeputy National Security Advisor for Strategic CommunicationsDouglas Lute' Ben Rhodes 2009''2009''Senior Advisor to the President and Assistant to the President for PublicEngagement and Intergovernmental AffairsValerie Jarrett 2009'' Deputy National Security Advisor for Homeland SecurityJohn O. Brennan2009''Director of Public Engagement Christina TchenJon Carson2009''112011''Deputy National Security Advisor and NSC Chief of Staff Denis McDonoughBrooke Anderson2009''102011''Director of Intergovernmental AffairsCecilia Mu±oz2009''White House Communications DirectorDaniel PfeifferJennifer Palmieri2009''132013''Director, National Economic Council Lawrence SummersGene Sperling2009''102011''Deputy White House Communications DirectorWhite House Press Secretary
Jen PsakiJennifer PalmieriRobert GibbsJay Carney2009''112011''132009''112011''Deputy Director, National Economic CouncilDiana Farrell2009''Deputy Press SecretaryBill Burton2009''11Deputy Director, National Economic CouncilDeputy Director, National Economic CouncilJason FurmanBrian Deese2009''2011''Director of Special ProjectsStephanie Cutter2010''11Chair of the President's Economic Recovery Advisory BoardPaul Volcker2009''Director of SpeechwritingJon Favreau2009''Chair of the Council of Economic Advisors Christina RomerAustan Goolsbee2009''102010''White House Counsel Assistant to the President for Legislative Affairs Robert BauerKathryn RuemmlerPhil SchiliroRob Nabors2009''112011''2009''112011''Member of the Council of Economic AdvisorsKatharine Abraham2011''Deputy Assistant to the President for Legislative AffairsLisa Konwinski2009''Member of the Council of Economic AdvisorsCecilia Rouse2009''Executive ClerkGeorge T. Saunders' 2009''Director, Office of Management and Budget Peter R. OrszagJacob Lew2009''102010''12Director, Office of Political AffairsChief Technology OfficerPatrick GaspardAneesh ChopraTodd Park2009''112009''122012''Chief Performance Officer and Deputy Director for Management, Office of Management and BudgetJeffrey Zients 2009''Chief Information OfficerDirector, Office of Presidential PersonnelSteven VanRoekelNancy Hogan2011''2010''Deputy Director, Office of Management and Budget Jeffrey LiebmanHeather Higginbottom*20102011''Director of Scheduling and Advance Director, White House Military OfficeAlyssa MastromonacoDanielle CrutchfieldGeorge D. Mulligan, Jr.2009''112011''2009''United States Trade RepresentativeRon Kirk2009''Cabinet SecretaryChris Lu2009''Director, Domestic Policy CouncilMelody Barnes2009''Deputy Cabinet SecretaryLiz Sears Smith2009''Deputy Director, Domestic Policy CouncilHeather HigginbottomMark Zuckerman2009''112011''Staff SecretaryLisa Brown2009''Director, Office of Faith-Based and Neighborhood PartnershipsJoshua DuBois2009''Director, Office of Management and AdministrationBradley Kiley2009''Director, Office of Health ReformNancy DeParle2009''11Director, Oval Office OperationsMicaela Fernandez2009''Deputy Director, Office of Health ReformJeanne Lambrew2009''Personal Aide to the PresidentReggie Love2009''Director, Office of Energy and Climate Change PolicyCarol Browner2009''11Personal Secretary to the PresidentKatie JohnsonAnita Decker Breckenridge2009''112011''Deputy Assistant to the President for Energy and Climate ChangeHeather Zichal2009''Special Projects Coordinator and Confidential Assistant to the PresidentEugene Kang 2009''Director, Council on Environmental QualityDirector, Office of National AIDS PolicyNancy SutleyJeffrey Crowley2009''2009''Chief of Staff to the First Lady Jackie NorrisSusan SherChristina Tchen20092009''102011''Director, Office of National Drug Control PolicyGil KerlikowskeMichael Botticelli (acting)2009''142014''White House Social SecretaryDesir(C)e RogersJulianna SmootJeremy Bernard2009''102010''112011''Director, Office of Urban AffairsAdolfo Carri"n, Jr.2009''Director, Office of Science and Technology PolicyJohn Holdren2009''PersondataNameHoldren, JohnAlternative namesShort descriptionAmerican scientist and presidential advisorDate of birthMarch 1, 1944Place of birthSewickley, PennsylvaniaDate of deathPlace of death
Why The Population Bomb Is a Rockefeller Baby | P U L S E
From the vaults:this piece by Steve Weissmanwas originally published in Ramparts in 1970. Ramparts was a literary quarterly for the left-leaning cognoscente that ran from 1962 to 1975 and whose contributors included Tariq Ali and Alexander Cockburn. Only a select few articles have made it online or been digitised. This is now one of them, a piece sent to us by Michael Barker. Its interesting to see what has '-- and hasn't '-- changed in the population debate and political climate in the four decades since.
Steve Weissman, 'Why The Population Bomb Is a Rockefeller Baby', in Ramparts, Eco-Catastrophe (1970), pp. 27-41.
Paul Ehrlich is a nice man. He doesn't hate blacks, advocate genocide or defend the empire. He simply believes that the world has too many people and he's ready at the drop of a diaper pin to say so. He's written his message in The Population Bomb, lectured it in universities and churches, and twice used America's own form of birth control, the late-night Johnny Carson Show, to regale bleary-eyed moms and dads with tales of a standing-room-only world, a time of famines, plague and pestilence.
Together with Berkeley's Kingsley Davis and Santa Barbara's Garrett Hardin, Ehrlich represents a newly-popular school of academics out to make overpopulation the central menace of our age. Except for a still hesitant Pope, their crusade seems sure of success. Everyone from Arthur Godfrey to beat poet Gary Snyder to the leaders of China's 700,000,000 (whom the populationists alternately ignore and disparage) now agrees that population growth is a problem and that something must be done. The question is what? Or, more precisely, who will do what '... and to whom?
Kingsley Davis, who finds voluntary family planning hopelessly futile, suggests that government postpone the age of marriage. Garrett Hardin in the April 22 Teach-In's Environmental Handbook urges mutual coercion mutually agreed upon. Paul Ehrlich wants to eliminate tax exemptions for more than two children, forgetting that the power to tax is the power to destroy. Voluntary family planning is out and population control in, leaving those less kindly disposed to the government to see the gaunt spectre of genocide. Long before even the least of the predicted ecological catastrophes comes to pass, such fears might well turn race on race, young on old, rich on poor.
Ehrlich, recognizing this danger, aims his appeal for smaller families less toward the poor and black than toward the white middle-class American family, which consumes more resources, occupies more space, and creates more waste than any ten of its economic inferiors. But his appeal, while barely denting the great waste-production economy, will only create the self-righteousness to impose America's middle-class will on the world.
We ''are going to have to adopt some very tough foreign policy positions,'' Ehrlich explains, and limiting our own families will let us do that ''from a psychologically strong position '... We must use our political power to push other countries into programs which combine agricultural development and population control.'' Exactly what kind of power, or whether we would use it globally, or simply in countries which food shipments and ''green revolutions'' might save from starvation, is unclear. But he hints at a time when we might put temporary sterilants in food and water, while some of his more adventurous colleagues, no doubt impressed by pinpoint bombing in Southeast Asia, would spray whole populations from the air. If we're so willing to napalm peasants to protect them from Communists, we could quite easily use a little sterilant spray to protect them from themselves.
We really needn't speculate, however, Uses of the new over-population scare are quite out of the hands of either nice academics or average anti-Communist Americans. The same elites and institutions which made America the world's policemen have long been eager to serve as the world's prophylactic and agricultural provisioner, and they are damned grateful to the academics for creating a new humanitarian justification for the age-old game of empire. The academics shouldn't really get the credit though. The heavies had it all planned out back in the '50s, while young Dr. Ehrlich was still studying water snakes in the western end of Lake Erie.
THE ROCKEFELLER FAMILY PLAN
In June 1952, John D. Rockefeller III, father of four, eldest grandson of Standard Oil and chairman of the Rockefeller Foundation, hosted a highly select conference on population in Colonial Williamsburg. To this showpiece of historical conservation, restored by the Rockefellers to its pre-Revolutionary beauty, came some 30 of the nation's most eminent conservationists, public health experts, Planned Parenthood leaders, agriculturalists, demographers and social scientists. After two and a half days of intensive discussion, they agreed to form a new group which could act as ''a coordinating and catalytic agent in the broad field of population.'' The following fall, John D. publicly christened The Population Council and announced that he himself would serve as its first president. With this act of baptism, the population bomb became a Rockefeller baby.
In the decades previous, birth control had been largely small potatoes. The Rockefeller Foundation, together with the Milbank Memorial Fund, had, in 1936, provided John D.'s alma mater, Princeton, with an Office of Population Research. Mississippi, Louisiana, Georgia, Florida and the Carolinas pioneered programs for the (sometimes voluntary) sterilization of the poor. Planned Parenthood, a direct descendant of Margaret Sanger's American Birth Control League, struggled to provide America's poor with free counsel and contraceptives. Guy Irving Burch's Population Reference Bureau, long the leading educator on population dynamics, was little more than a one-man show, as was the Hugh Moore Fund, set up in 1944 by the founder and board chairman of Dixie Cup ''to call to the attention of the American Public the dangers inherent in the population explosion.''
Once the Rockefellers joined the family, however, family planning became a very different kind of business. The Ford Foundation, Carnegie, the Commonwealth and Community Funds, the Molt Trust and the Mellons joined with John D., his mother, his sister (wife of banker Jean Mauze), his brother and their financial adviser, AEC chairman Lewis Strauss, in pumping fresh blood and money into the Population Council, some of which even trickled over into the Reference Bureau and Planned Parenthood. Wealthy Englishmen and Swedes and their third world associates joined with the Americans in making Planned Parenthood international. The World Bank, headed by Chase National Bank vice president and future Population Council director Eugene Black, put its money behind Princeton's pioneer study on population and economic growth in India. Where birth controllers once went begging, now guest lists at Planned Parenthood banquets and signatures on ubiquitous New York Times ads read like a cross between the Social Register and Standard and Poor's Directory of Corporation Executives.
This sudden interest of the world's rich in the world's poor, whatever the humanitarian impulse, made good dollars and cents. World War II had exhausted the older colonial empires, and everywhere the cry of nationalism sounded: from Communists in China and Southeast Asia, from neutralists in Indonesia and India, from independence movements in Africa and from use of their own oil and iron ore and, most menacing, the right to protect themselves against integration in an international marketplace which systematically favored the already-industrialized.
But the doughty old buzzards of empire were determined to save the species. They would pay deference to the new feelings by encouraging a bit of light industry here, and perhaps even a steel mill there. To give the underdeveloped areas what Nelson Rockefeller termed ''a community of interest with us,'' and to extend control, they would give public loans and foreign aid for roads, dams and schools. Their foundations and universities would train a new class of native managers who, freed from outmoded ideologies, would clearly see that there was more than enough for both rich and poor.
But there wasn't enough, especially not when the post-war export of death-control technology created so many more of the poor. The poor nations rarely came close to providing even the limited economic security which, as in Europe of the Industrial Revolution, would encourage people to give up the traditional peasant security of a large family and permit the population curve to level off. In fact, for much of the population, the newly-expanded money economy actually increased insecurity. Faced with this distortion between fertility and development, developed country elites could see no natural way of stopping population growth. All they could see was people, people, people, each one threatening the hard-won stability which guaranteed access to the world's ores and oil, each one an additional competitor for the use of limited resources.
More people, moreover, meant younger people, gunpowder for more than a mere population explosion. ''The restlessness produced in a rapidly growing population is magnified by the preponderance of youth,'' reported the Rockefeller Fund's overpowering Prospect for America. ''In a completely youthful population, impatience to realize rising expectations is likely to be pronounced. Extreme nationalism has often been the result.''
HOLDING BACK
It was to meet these perils of population that the Rockefellers and their kindred joined the family planning movement in such force. But until they had completed a much more thoroughgoing prophylaxis of the new nationalisms, and had worked out an accommodation with Catholic opposition, they were much too sophisticated to preach birth control straight out. That would have sounded far too reminiscent of the older colonialisms and, indirectly, too much like a condemnation of the new pattern of ''development.''
Consequently, until the spurt of technical assistance in the '60s, the Population Council preached and, within the ideological confines of development thinking, practiced ''the scientific study of population problems.'' They provided fellowships to Americans and, as part of the broader building of native elites, to deserving foreign students. This, they hoped, would build up a cadre of ''local personnel,'' well-studied in population problems, ''trained in objective scientific methods and able to interpret the results to their own people.'' The Council also undertook population studies in the colonies, funded both demographic and medical studies at U.S. universities, worked with international agencies, and maintained its own biomedical lab at Rockefeller Institute. The foundations supplemented this approach, directly funding roughly a dozen major university think-tanks devoted to population studies. These grants no more bought scholars and scholarship than native elites. It was more efficient to rent them. Like Defense Department dollars or direct corporation gifts, the smart population money posed the right (as opposed to the left) questions, paid off for right answers, and provided parameters for scholars interested in ''realistic'' policy alternatives.
Study, of course, was an apprenticeship for action. By 1957, an ''Ad Hoc Committee'' of population strategists from the Council the Rockefeller Fund, Laurance Rockefeller's Conservation Foundation and Planned Parenthood mapped out a full population control program. Published by Population Council President Frederick Osborn as Population: An International Dilemma, the committee's report insisted that population growth, in the rich nations as well as the poor, would become a decisive threat to political stability. To preempt such instability, the population planners planned first to win over the educated classes, many of whom themselves felt the threat of population. But, wary of widespread personal sensitivities and nationalist sentiments, they would never push birth control as an end in itself. Instead they would have it grow out of the logical needs of family planning, and leave the task of gaining public acceptance to the native elite, many of whom they had trained.
An even more important antidote to nationalist reaction was the population planners' admission that population was also a problem here in the U.S. ''Excessive fertility by families with meager resources must be recognized as one of the potent forces in the perpetuation of slums, ill-health, inadequate education, and even delinquency,'' the Ad Hoc Committee noted. They were satisfied, however, with the overall ''balance of population and resources'' in this country and sought only to use tax, welfare and education policy ''to equalize births between people at different socio-economic levels'' and to ''discourage births among the socially handicapped.''
GETTING THE GOVERNMENT IN
For all their domestic concern, however, population planners were primarily absorbed in ''the international dilemma'' and the problems of ''economic development.'' Like Walt Rostow, Max Millikan and the authors of the Rockefellers' Prospect for America, they emphasized top-down national planning, Western-influenced elites, foreign aid penetration, and the use of economic growth, rather than distribution and welfare, to measure development. As a result, their plan for population bore a scary resemblance to the first Vietnamization which was then recasting the educational system, banking and currency, public works, agriculture, the police, and welfare programs of Vietnam into an American mold.
The population planners' counter to insurgency then entered ''official'' development thinking in 1959, in the Report of President Eisenhower's Committee to Study the Military Assistance Program. Headed by General William H. Draper II (perhaps best remembered as the American government official who most helped Nazi and Zaibatsu industrialists re-concentrate their power after World War II), the committee urged that development aid be extended to local maternal and child welfare programs, to the formulation of national population plans, and to additional research on population control.
Ike, a bit old-fashioned about such intimate intervention, flatly refused. He just could not ''imagine anything more emphatically a subject that is not a proper political or government activity or function or responsibility '... This government '... will not '... as long as I am here, have a positive policy doctrine in its program that has to do with this problem of birth control. That's not our business.''
Business disagreed, the Draper Report became the rallying cry of big business' population movement, and General Draper, an investment banker by trade, headed up both Planned Parenthood's million dollar-a-year World Population Emergency Campaign and even bigger Victor Fund Drive.
The foundations also expanded their own programs. But the Rockefellers, Fords, Draper, and others seemingly born into the population movement hadn't gotten rich by picking up such large tabs; not if they could help it. Despite Ike's sense of propriety, they had continued to press for government sponsorship of birth control '' and not without piecemeal gains, even in the Eisenhower government.
When Kennedy became President he agreed to a government role in research, promising to pass requests for birth control information and technical assistance to the foundations, and permitting Deputy Assistant Secretary of State Richard Gardner to make an offer of U.S. family planning aid to the UN.
But none of this satisfied the population people, who, beginning in 1963, made a big public push for major government programs in both domestic and overseas agencies. In May of that year, the blue-ribbon American Assembly, with the help of the Population Council, brought ''The Population Dilemma'' to a convocation of leaders from all walks of American life. The National Academy of Sciences, assisted professionally and financially by the Council, issued a scary report on The Growth of World Population. Draper, Moore, and Harper & Row's Cass Canfield then set up the Population Crisis Committee, ''the political action arm of the population control movement,'' to publish ads, lobby government officials and promote public support for government aid to family planning.
Sometimes the population people defended their proposals on humanitarian grounds; at other times they were more candid: ''If the World Bank expects to get its loans repaid by India,'' explained Draper, ''if the U.S., much of whose aid is in the form of loans, expects to have them repaid '... the population problem '... must be solved.'' Bolstered by Fulbright, Gruening and other long-term congressional advocates of ''economic development,'' and by a public reversal of position by former President Eisenhower, the campaign pushed the Kennedy, then the Johnson government closer to open birth control programs.
But fear of domestic controversy, especially in the Catholic community, and a lack of positive foreign response held the movement in check until the White House Conference on International Cooperation, keynoted by John D. Rockefeller III, in November 1965. The Conference Committee on Population '' chaired by Gardner and including Black, Canfield, Draper and John D. '' then urged that the government greatly expand its birth control assistance to foreign countries. Conference committees on Food and Agriculture and Technical Cooperation and Investment concurred, urging a multilateral approach.
Much impressed by this show of ''public support,'' the very next session of Congress passed Johnson's ''New Look'' in foreign policy, which made birth control part of foreign assistance and permitted the President to judge a nation's ''self-help'' in population planning as a criterion for giving Food for Freedom aid. (Separate legislation gave the Department of Health, Education and Welfare a birth control program for domestic consumption.) The ''New Look,'' which combined population control with agricultural development, international education, encouragement of private overseas investment, and multilateral institution-building, was, of course, the response of the mid-'50's to nationalism. It was also a foretaste of what Paul Ehrlich's ''tough foreign policy positions'' would easily become.
THE GREEN REVOLUTION
The new look in intervention got a good test in the Indian famine of '65 and '66 '' until Biafra the best-advertised famine in recent times, and a major boost for the population control campaign. Ever since the victory of the Chinese Revolution, India has been a bastion of the ''free [enterprise] world.'' But Western businessmen long fretted over her ''neutralism'' and ''socialism'' and her restrictions on foreign participation in key areas of the economy.
In 1958, India faced a devastating foreign exchange crisis. In response, the World Bank and the ''Aid India Club'' promised one billion dollars a year in aid, and international investors found themselves with golden opportunities. The Ford Foundation quickly stepped in with a ''food crisis'' team of experts, which pushed India's planners into increased agricultural spending, ultimately at the expense of planned investments in housing and other social services. Several rounds of business conferences on India together with official and semi-official visits followed until, in 1964, Undersecretary of Commerce Franklin Delano Roosevelt, Jr. led a top-flight delegation of American business executives to New Delhi with the explicit objective of ''persuading the government to adopt policies more attractive to potential investors.''
Hunger warriors from agribusiness were particularly hot for expansion. Poor harvest in prior years had driven food prices up, and with them, the demand for fertilizer and pesticides. Consequently, the Rockefeller's Jersey Standard wanted price and distribution restrictions lifted on their Bombay fertilizer plant. A Bank of America syndicate, together with India's Birla group, needed government support for what would become ''the largest urea and compound fertilizer plant in this part of the world.'' Petroleum producers, foreseeing an otherwise useless excess of naphtha, wanted permission to set up fertilizer plants which could utilize the petroleum by-product. The Ford and Rockefeller foundations wanted to expand use of their new high yield seeds deliberately bred for large fertilizer and pesticide inputs, and get on with the commercialization of agriculture.
But Western pressure was of little avail until the failure of the summer monsoons in 1965. Then, in the words of the World Bank's Pearson Report, ''Instead of signing annual or multi-year [food] sales agreements, as with other countries and with India itself, in earlier years, the United States doled out food aid a few months at a time as policy conditions were agreed upon.''
India, faced with a short leash on food supplies, acceded to the foreign pressures. She pared down government control, liberalized her import restriction and devalued the rupee. Her government gave the chemical and oil men permission to build new fertilizer plants, to fix their own prices, to handle their own distribution outside the normal channels of the rural cooperatives, and to maintain a greater share of management control than permitted under Indian law. Most important, officials agreed to give greater emphasis to agriculture and to maintain high food prices as an incentive to growers. ''Call them 'strings', call them `conditions,' or whatever one likes,'' boasted the New York Times, ''India has little choice now but to agree to many of the terms that the United States, through the World Bank, is putting on its aid. For India simply has nowhere else to turn.''
With the ground so carefully prepared, the miracle seeds grew beautifully. Once-barren land flowered. Indian farmers harvested 95 million tons of grain in 1967-68, bettering the best of previous yields by five per cent. The following year they did almost as well, and growers laid plans for 100 million metric tons in 1969-70. Ecstatic Indian government officials announced that India would be self-sufficient in food production by 1971. ''The Green Revolution,'' exclaimed David Rockefeller to the International Industrial Conference, ''may ultimately have a cumulative effect in Asia, Africa, and Latin America such as the introduction of the steam engine had in the industrial revolution.''
REVOLUTION OF A DIFFERENT COLOR
The pressure, bantered about everywhere from the Canarsie Shopping News to Business Week, had been anything but subtle. Profits would be high. Yet even liberals like John Kenneth Galbraith and Chester Bowles, both former ambassadors to New Delhi, lavishly praised the whole enterprise. People have to eat.
They have to, but even with paternalistic green revolutions they still don't always get to. ''Modern'' agriculture in America and the West, dependent upon high inputs of fertilizer and pesticides, is an ecological disaster. We are only now discovering what DDT and many fertilizers do to our food, water, soil, mother's milk and farm workers. India's prospects are even more bleak. Chemically resistant miracle grains will soon produce miracle pests, which could easily wipe out whole areas. Early high yields depended heavily on unusually good weather '' which is not dependable, and on irrigation '' which is reportedly salting the soil. These problems have led many experts to question how long the revolution will remain green. But most of the experts still come down on the side of more ''modern'' agriculture, without even exploring possibly safer alternatives like the high-yield, labor-intensive and biologically-integrated ''gardening'' of the best traditional Asian agriculture.
But the real disaster is more immediate. The same high food prices which gave incentive to growers also put sufficient food out of the reach of those who need it most. Commercial agriculture, by definition, produces for profit, not people. At the same time, the new seeds required irrigation and pesticides, and heavy inputs of fertilizer, the costs of which soared with the removal of government price ceilings. ''So far,'' reports Clifton Wharton, Jr., writing in Foreign Affairs, ''spectacular results have been achieved primarily among the relatively large commercial farmers.'' Those who haven't the capital, or can't get the credit from village moneylenders or meager government programs, are pushed off their land and into an agricultural proletariat or worse, while the new Kulaks, the peasant capitalists, re-invest their profits in modern labor-saving machinery.
The inevitable result of this trend is class and regional conflict. Wharton reports a clash in the prize Tanjore district of Madras in which 43 persons died in a struggle between landlords and the landless, ''who felt they were not receiving their proper share of the increased prosperity brought by the Green Revolution.'' Two Swedish journalists, Lasse and Lisa Berg, reporting in Stockholm's Sondagsbilagan, provide pictures of ''excess'' Indian peasants burned in kerosene by a landlord. One hates to speculate on how a companion population program would work, but it is all too easy to believe reports from India of forced sterilization.
But there is a positive side. As in the Philippines, where peasants displaced by the commercialization of agriculture are strengthening the Huk resistance, the Green Revolution in India is producing a Red Revolution. For the first time since Independence, militant revolutionary movements have led Indian peasants into rebellions in different parts of the country, and in certain areas, the Bergs report, the poorest people in the countryside are organizing themselves across the boundaries of caste.
THE NEW INTERNATIONALISM
Despite all a Rockefeller might do, the New Look in empire even met obstacles at home. From 1966 on, displeasure with the unwinnable war in Vietnam escalated along with the war-caused inflation, and Congress, though it had authorized the new programs, was increasingly unwilling to fund any new foreign entanglements. In the spring of 1967, for example, Senator Fulbright, impressed with what the White House Conference's Committee on Population had proposed, asked Congress to support voluntary family planning abroad with an appropriation of $50 million a year for three years. His less liberal colleagues approved $35 million for one year. Congress has treated the domestic birth control issue with the same lack of enthusiasm, despite the growth of third world nationalism within the U.S. Members of Congress are just too provincial to understand the needs of empire.
In an attempt to create a congressional climate more favorable to population control, the empire builders decided to drum up some public pressure for their cause. Consequently, a new avalanche of full-page spreads warned war-weary newspaper readers that ''The Population Bomb Threatens the Peace of the World''; that ''Hungry Nations Imperil the Peace of the World''; that ''Whatever your cause, it's a lost cause unless we control population.'' The ads, sponsored by Hugh Moore's Campaign to Check the Population Explosion and signed by the usual crew of population controllers, urged greatly expanded appropriations and a crash program for population stabilization. A new Presidential Committee on Population and Family Planning, headed by HEW Secretary Wilbur Cohen and, of course, John D. III, persuaded Nixon to promise greatly-expanded federal programs and a commission on domestic population problems. The Ford Foundation, initiating its first grants for birth control assistance in the U.S. in 1966, provided a barrage of money and reports. The American Assembly, with the help of the Kellog Foundation and now-Secretary of Agriculture Clifford Hardin, sponsored a national conference on Overcoming World Hunger which, despite its optimism about the green revolution, continued to push for population control. Hugh Moore pushed Ehrlich's book and his own ads. Draper urged doubling the 1970 AID appropriation for birth control to $100,000 and was warmly applauded by James Riddleberger, his successor as head of the Population Crisis Committee. Environmentalists, along with their enemies, ''the industrial polluters,'' found the chief cause of every problem from slums to suburbs, pollution to protest, in the world's expanding numbers.
More than ever, the population power structure pushed for a world population policy. From the early '50s, the population people realized thee sensitivities '' religious, ideological, military, political and personal '' raised by the offer of birth control assistance, and always advocated international programs. Then, when domestic reaction to intervention in Vietnam soured the overall population control effort, they quickly joined in the generalized elitist move to transfer the entire economic development program to international agencies, where they and their third world friends could directly control the programs without interference from congressional ''hicks.''
The UN should take the leadership in responding to world population growth. So urged a special United Nations Association panel headed by John D., financed by Ford, and including Richard Gardner, former World Bank president George Woods, former AID administrator and now Ford Director of International Operations David E. Bell, and AID director John A. Hannah. The committee urged the creation of a UN Commissioner of Population with broad powers to coordinate ''radically upgraded'' population activities. The Commissioner would work under the United Nations Development Program, whose director, Paul Hoffman, is a former president of the Ford Foundation, administrator of the Marshall Plan, and aide to General Draper in the reconquest of Japan by big business. Under Hoffman's guidance, the second UN Decade of Development is already preparing to concentrate on agricultural development, education, and population control.
The American population elite is also trying to beef up the Development Assistance Committee (DAC) of the Organization for Economic Cooperation and Development, which brings together the old Marshall Plan nations with Japan, Australia, Canada and the United States. Since the mid-'60s, DAC has given greater efforts to coordinating the agricultural and population control aid of the members. James Riddleberger, Draper's replacement on the Population Crisis Committee, was the first chairman of DAC, while the present chairman, former State Department official Edwin Martin, served as a staff member of the original Draper Committee.
Most important in the new internationalism is the World Bank. Headed by Robert McNamara, veteran of population control efforts in Vietnam, the Bank is now developing the management capacity to become the key institution in administering the empire. ''Just as McNamara concentrated on the cataclysmal, the nuclear threat, while at the Department of Defense,'' gushed a New York Times feature, ''so at the World Bank he has chosen to make the population explosion, another cataclysmal problem, his central, long-range preoccupation. For if populations are allowed to double every 20 years, as they do in low-income countries, it will wipe out the effect of development and lead to chaos.'' Aided by former AID administrator William S. Gaud, now executive vice-president of the World Bank's International Finance Corporation, and former Alliance for Progress chief Covey T. Oliver, now U.S. delegate to the World Bank, McNamara is currently preparing for the day when the great statesmen meet to discuss the control of population.
With support in the White House and agreement among their friends (the trustworthy American managers in the international agencies), everything seems to favor the new interventionism of the big business internationalists. Everything, that is, except a new-found popular preference for non-intervention, or even isolation. But if overpopulation per se becomes the new scapegoat for the world's ills, the current hesitations about intervention will fall away. Soon everyone, from the revolting taxpayer who wants to sterilize the Panther-ridden ghettos to the foreign aid addict, will line up behind the World Bank and the UN and join the great international crusade to control the world's population. Let empire save the earth.
Simply fighting this war on people with a people's war will not eliminate the need for each nation to determine how best to balance resources and population. But where there is greater economic security, political participation, elimination of gross class division, liberation of women, and respected leadership, humane and successful population programs are at least possible. Without these conditions, genocide is nicely masked by the welfare imperialism of the West. In the hands of the self-seeking, humanitarianism is the most terrifying ism of all.
From the 1970 biographical note: Steve Weissman is a member of the Pacific Studies Center in Palo Alto, California. The Center is a research collective specializing in the social, political and economic dimensions of American capitalism. Projects range from studies and publications on U.S. involvement in the Third World, multinational corporations, labor problems, high finance and environmental destruction, to films on ecology and inflation.
Like this:LikeLoading...
Related
Tagged:Paul Erlich, Ramparts, Rockefeller, Steve Weissman
Eutrophication is a serious problem in Polish freshwaters. Mass occurrences of toxic cyanobacteria in reservoirs cause problems in the production of safe drinking water and the diversity of produced toxins complicates monitoring of freshwaters. The aim of this study was to estimate the efficiency of water treatment processes in the removal of microcystins (MCs), cyanobacterial hepatotoxins. Elimination of microcystins was studied at two waterworks, which supply drinking water to the city of Lodz from Sulejow Reservoir. The consecutive steps of pre-oxidation, coagulation, sand filtration, ozonation and chlorination used in the water treatment showed effective elimination of microcystins in water from Sulejow Reservoir in 2002 and 2003. The highest total concentration of microcystin (variants MC-RR, MC-YR, MC-LR) amounted to 6.7 microgl(-1) in raw water and was detected on the 13th of August 2002. In 2003 the water utility decided to increase the contribution of ground water in the production of drinking water. This resulted in a decrease of microcystin in water during and after the treatment process. The current management strategy of the waterworks company includes mixing of surface water and ground water, which reduces the hazards caused by toxic cyanobacterial blooms in the reservoir.
Cyanobacteria in Florida waters can BE TREATED effectively
Cyanobacteria, or blue-green algae, are commonly found as individual cells, clumps, filaments or large mats in Florida's lakes, rivers and estuaries.Cyanobacteria are some of the Earth's oldest organisms, with fossils dating back 3.5 billion years. Yet, they can still be found today in all of Florida's freshwater and brackish habitats '' lakes, rivers and estuaries. Like red tides, cyanobacteria can grow and accumulate, or bloom, when environmental conditions such as light availability and temperature are favorable. Nutrient pollution from agricultural and urban runoff causes the majority of freshwater cyanobacteria blooms. Other conditions that contribute to blooms are stagnant water resulting from a lack of natural flushing and land clearing. Cyanobacteria blooms can destroy submerged vegetation like seagrass by blocking sunlight. Blooms can also reduce oxygen availability to other aquatic organisms and introduce toxins that pass through the food chain. Toxins produced by cyanobacteria can be harmful to humans, affecting the liver (hepatotoxins), the nervous system (neurotoxins) and skin (dermatotoxins).
Several groups of toxic cyanobacteria have been detected in Florida's waters. The groups Microcystis, Anabaena and Cylindrospermopsis and their associated toxins '' microcystins, anatoxin-a and cylindrospermopsin, respectively '' all occur in Florida freshwater systems, including those used for drinking water. Persistent cyanobacteria blooms have affected many of Florida's aquatic systems, including Lake Okeechobee; the Harris Chain of Lakes (Apopka, Eustis, Griffin and Harris); and the St. Johns, St. Lucie and Caloosahatchee rivers and estuaries.
If ingested, water contaminated with toxic cyanobacteria can cause nausea, vomiting and, in severe cases, acute liver failure. In 2001, scientists discussed needs and methods for effective detection and treatment methods of toxins produced by cyanobacteria in drinking water reservoirs at the Cyanotoxin Detection and Quantification and Instrumentation Workshop. Although the presence of cyanobacterial toxins in reservoir systems used for drinking water is of potential concern in Florida, there have been no documented illnesses directly related to drinking water containing these toxins. Water treatment plants can effectively treat for one type of toxin '' microcystins. These toxins can result in skin irritation, swollen lips, eye irritation, earaches, sore throats, hay fever-like symptoms (sneezing and runny nose) and fatigue after swimming in affected lakes.
The best way to prevent exposure to blue-green algae toxins is to avoid water where scum, foam or algae mats are present or where water is a greenish color. The Florida Department of Health offers these additional precautions:
Do not drink, cook or shower with untreated water from lakes, ponds or streams.Do not allow pets or livestock to swim in or drink scummy water.If you or your animals accidentally get into a blue-green algae bloom, wash with fresh water and soap after skin contact, and avoid swallowing or inhaling water. Wash animals' fur thoroughly before they start to groom themselves.Avoid exposure to irrigation water drawn from untreated sources.Notify your local water quality officials if you notice unusual changes in the taste or smell of your tap water.The Florida Department of Health's Aquatic Toxins Program provides more information on cyanobacteria and their toxins related to human health. More information on cyanobacteria blooms, their toxins and public health effects can also be found in the Proceedings of Health Effects of Exposure to Toxic Cyanobacteria Toxins (PDF File '' 1.08 MB).
To report any illness resulting from cyanobacteria exposure, call the Florida Poison Information Center at 800-222-1222. To report dead, diseased or abnormally behaving fish, call the FWRI Fish Kill Hotline toll free at 800-636-0511 or report the kill online.
You will need Adobe Reader to view PDF files. To download Adobe Reader, visit http://get.adobe.com/reader/
Toxic Algal Blooms Connected to Climate Change and Industrial Agriculture | EcoWatch
Nutrient enrichment and climate change are posing yet another concern of growing importance'--an apparent increase in the toxicity of some algal blooms in freshwater lakes and estuaries around the world, which threatens aquatic organisms, ecosystem health and human drinking water safety.
As this nutrient enrichment, or ''eutrophication'' increases, so will the proportion of toxin-producing strains of cyanobacteria in harmful algal blooms, scientists said.
Toxic microcystin bacteria float, along with this dead fish, on the surface of freshwater lakes. Photo credit: Oregon State UniversityResearchers from Oregon State University and the University of North Carolina at Chapel Hill will outline recent findings in an analysis Friday in the journal Science.
Cyanobacteria are some of the oldest microorganisms on Earth, dating back about 3.5 billion years to a time when the planet was void of oxygen and barren of most life. These bacteria are believed to have produced the oxygen that paved the way for terrestrial life to evolve. They are highly adaptive and persistent, researchers say, and today are once again adapting to new conditions in a way that threatens some of the life they originally made possible.
A particular concern is Microcystis sp., a near-ubiquitous cyanobacterium that thrives in warm, nutrient-rich and stagnant waters around the world. Like many cyanobacteria, it can regulate its position in the water column, and often forms green, paint-like scums near the surface.
In a high-light, oxidizing environment, microcystin-producing cyanobacteria have a survival advantage over other forms of cyanobacteria that are not toxic. Over time, they can displace the nontoxic strains, resulting in blooms that are increasingly toxic.
''Cyanobacteria are basically the cockroaches of the aquatic world,'' said Timothy Otten, a postdoctoral scholar in the OSU College of Science and College of Agricultural Sciences, whose work has been supported by the National Science Foundation. ''They're the uninvited guest that just won't leave.''
A thick mat of toxic microcystins cyanobacteria on Lake Taihu in China gets stirred up in the wake of a boat. Photo credit: Hans Paerl/ University of North Carolina''When one considers their evolutionary history and the fact that they've persisted even through ice ages and asteroid strikes, it's not surprising they're extremely difficult to remove once they've taken hold in a lake,'' Otten said. ''For the most part, the best we can do is to try to minimize the conditions that favor their proliferation.''
Researchers lack an extensive historical record of bloom events and their associated toxicities to put current observations into a long-term context. However, Otten said, ''If you go looking for toxin-producing cyanobacteria, chances are you won't have to look very long until you find some.''
There are more than 123,000 lakes greater than 10 acres in size spread across the U.S., and based on the last U.S. Environmental Protection Agency's National Lakes Assessment, at least one-third may contain toxin-producing cyanobacteria. Dams, rising temperatures and carbon dioxide concentrations, droughts, and increased runoff of nutrients from urban and agricultural lands are all compounding the problem.
Many large, eutrophic lakes such as Lake Erie are plagued each year by algal blooms so massive that they are visible from outer space. Dogs have died from drinking contaminated water.
Researchers studying cyanobacterial toxins say it's improbable that their true function was to be toxic, since they actually predate any predators. New research suggests that the potent liver toxin and possible carcinogen, microcystin, has a protective role in cyanobacteria and helps them respond to oxidative stress. This is probably one of the reasons the genes involved in its biosynthesis are so widespread across cyanobacteria and have been retained over millions of years.
Because of their buoyancy and the location of toxins primarily within the cell, exposure risks are greatest near the water's surface, which raises concerns for swimming, boating and other recreational uses.
Researchers take samples from Lake Taihu in China, when it was heavily contaminated with toxic algal blooms that turned the surface water green. Photo credit: Oregon State UniversityAlso, since cyanobacteria blooms become entrenched and usually occur every summer in impacted systems, chronic exposure to drinking water containing these compounds is an important concern that needs more attention, Otten said.
''Water quality managers have a toolbox of options to mitigate cyanobacteria toxicity issues, assuming they are aware of the problem and compelled to act,'' Otten said. ''But there are no formal regulations in place on how to respond to bloom events.
''We need to increase public awareness of these issues,'' Otten concluded. ''With a warming climate, rising carbon dioxide levels, dams on many rivers and overloading of nutrients into our waterways, the magnitude and duration of toxic cyanobacterial blooms is only going to get worse.''
Microcystins are cyclic nonribosomal peptides produced by cyanobacteria (e.g., Microcystis aeruginosa and Planktothrix). They are cyanotoxins and can be very toxic for plants and animals including humans. Their hepatotoxicity may cause serious damage to the liver. Microcystins can strongly inhibit protein phosphatases type 1 (PP1) and 2A (PP2A), and are linked to pansteatitis.[1]
Characteristics[edit]Microcystins consist of several uncommon non-proteinogenicamino acids such as dehydroalanine derivatives and the special β-amino acid ADDA, (all-S,all-E)-3-amino-9-methoxy-2,6,8-trimethyl-10-phenyldeca-4,6-dienoic acid).
Microcystin-LR is one of over 80 known toxic variants and is the most studied by chemists, pharmacologists, biologists and ecologists. Microcystin-containing 'blooms' are a problem worldwide, including China, Brazil, Australia, South Africa,[2][3][4][5][6][7][8][9] the United States and much of Europe. Once ingested, microcystin travels to the liver, via the bile acid transport system, where most is stored; though some remains in the blood stream and may contaminate tissue.[10][11] Microcystin binds covalently to protein phosphatases thus disrupting cellular control processes.
Exposure[edit]There appears to be inadequate information to assess carcinogenic potential of microcystins by applying EPA Guidelines for Carcinogen Risk Assessment. A few studies suggest that there may be a relationship between liver and colorectral cancers and the occurrence of cyanobacteria in drinking water in China [12][13][14][15](Yu et al., 1989; Zhou et al., 2002). Evidence is, however, limited due to limited ability to accurately assess and measure exposure.
The impact of exposure to microcystin by patients with a compromised immune system is not yet fully known, but is starting to raise some concern.[16]
Pathways[edit]There is some evidence that the toxin can be transported via irrigation into the food chain [17][18] but this still needs additional verification.
Recent developments[edit]On 2 August 2014, the City of Toledo, Ohio discovered Microcystin in its water supply due to harmful algal blooms (HABs) in Lake Erie, the shallowest of the Great Lakes. The affected water plant supplies approximately 500,000 people.[19][20] Algal blooms occur more frequently and scientists predicted this significant bloom of blue-green algae, and projected a peak in early September.[21]
See also[edit]References[edit]^http://www.pwrc.usgs.gov/health/rattner/rattner_blackwaternwr.cfm^Bradshaw, D., Groenewald, P., Laubscher, R., Nannan, N., Nojilana, B., Norman, B., Pieterse, D. and Schneider, M. (2003). Initial Burden of Disease Estimates for South Africa, 2000. Cape Town: South African Medical Research Council.^Fatoki, O.S., Muyima, N.Y.O. & Lujiza, N. 2001. Situation analysis of water quality in the Umtata River Catchment. Water SA, (27) Pp 467-474.^Oberholster, P.J., Botha, A-M. & Grobbelaar, J.U. 2004 Microcystis aeruginosa: Source of toxic microcystins in drinking water. Africa Journal of Biotechnology 3: 159-168.^Oberholster, P.J., Botha, A-M. & Cloete, T.E. 2005 An overview of toxic freshwater cyanobacteria in South Africa with special reference to risk, impact and detection by molecular marker tools. Biokem17: 57-71.^Oberholster, P.J. & Botha, A-M. 2007. Use of PCR based technologies for risk assessment of a winter cyanobacterial bloom in Lake Midmar, South Africa. African Journal of Biotechnology. (6) Pp 14-21.^Oberholster, P. 2008. Parliamentary Briefing Paper on Cyanobacteria in Water Resources of South Africa. Annexure ''A'' of CSIR Report No. CSIR/NRE/WR/IR/2008/0079/C. Pretoria. Council for Scientific and Industrial Research (CSIR).^Oberholster, P.J., Cloete, T.E., van Ginkel, C., Botha, A-M. & Ashton, P.J. 2008. The use of remote sensing and molecular markers as early warning indicators of the development of cyanobacterial hyperscum crust and microcystin-producing genotypes in the hypertrophic Lake Hartebeespoort, South Africa. Pretoria: Council for Scientific and Industrial Research (CSIR).^Oberholster, P.J. & Ashton, P.J. 2008. State of the Nation Report: An Overview of the Current Status of Water Quality and Eutrophication in South African Rivers and Reservoirs. Parliamentary Grant Deliverable. Pretoria: Council for Scientific and Industrial Research (CSIR).^Falconer, I.R. 1998. Algal toxins and human health. In Hrubec, J. (Ed.), Handbook of Environmental Chemistry, Volume 5 (Part C). Berlin: Springer-Verlag. Pp. 53-82.^Falconer, I.R. 2005. Cyanobacterial Toxins of Drinking Water Supplies: Cylindrospermopsins and Microcystins. Florida: CRC Press. 279 pages.^Humpage, A.R., Hardy, S.J., Moore, E.J., Froscio, S.M. & Falconer, I.R. 2000. Microcystins (cyanobacterial toxins) in drinking water enhance the growth of aberrant crypt foci in the colon. Journal of Toxicology and Environmental Health. (61) Pp 101-111.^Ito, E., Kondo, F., Terao, K. & Harada, K.-L. 1997. Neoplastic nodular formation in mouse liver induced by repeated intraperitoneal injection of microcystin-LR. Toxicon. (35) Pp 1453-1457.^Nishiwaki-Matushima, R., Nishiwaki, S., Ohta, T., Yoszawa, S., Suganuma, M., Harada, K., Watanabe, M.F. & Fujiki, H. 1991. Structure-function relationships of microcystins, liver-tumor promoters, in interaction with protein phosphatase. Japanese Journal of Cancer Research. (82) Pp 993-996.^Ueno, Y., Nagata, S., Tsutsumi, T., Hasegawa, A., Watanabe, M.F., Park, H.D., Chen, G.C. & Yu, S. 1996. Detection of microcystins in blue-green algae hepatotoxin in drinking water sampled in Haimen and Fusui, endemic areas of primary liver cancer in China, by highly sensitive immunoassay. Carcinogenesis. (17) Pp 1317-1321.^Doyle P. (1991). The Impact of AIDS on the South African Population. AIDS in South Africa: The Demographics and Economic Implications. Centre for Health Policy, University of the Witwatersrand, Johannesburg, South Africa.^Codd, G.A,, Metcalf, J.S. & Beattie, K.A. 1999. Retention of Microcystis aeruginosa and microcystin by salad lettuce after spray irrigation with water containing cyanobacteria. Toxicon, (37) Pp. 1181-1185.^Abe, T., Lawson, T., Weyers, J.D.B,, & Codd, G.A. 1996. Microcystin-LR inhibits photosynthesis of Phaseolus Vulgaris primary leaves: implications for current spray irrigation practice. New Phytol. 133: 651-658.^"Algal bloom leaves 500,000 without drinking water in northeast Ohio". Reuters. August 2, 2014. ^Rick Jervis, USA TODAY (August 2, 2014). "Toxins contaminate drinking water in northwest Ohio". ^John Seewer. "Don't drink the water, says 4th-largest Ohio city". National Center for Environmental Assessment. Toxicological Reviews of Cyanobacterial Toxins: Microcystins LR, RR, YR and LA (NCEA-C-1765)Yu, S.-Z. 1989. Drinking water and primary liver cancer. In: Primary Liver Cancer, Z.Y. Tang, M.C. Wu and S.S. Xia, Ed. China Academic Publishers, New York, NY. p. 30-37 (as cited in Ueno et al., 1996 and Health Canada, 2002).Zhou, L., H. Yu and K. Chen. 2002. Relationship between microcystin in drinking water and colorectal cancer. Biomed. Environ. Sci. 15(2):166-171.External links[edit]
400,000 Ohio Residents Left Without Water Due to Widespread Contamination
A woman in Toledo, Ohio stocks up on bottled water after a major contamination of the tap water supply on August 2, 2014.Image: John Seewer/Associated Press
By The Associated Press2014-08-02 20:51:58 UTC
Toxins possibly from algae on Lake Erie fouled the water supply of the state's fourth-largest city Saturday, forcing officials to issue warnings not to drink the water and the governor to declare a state of emergency as worried residents descended on stores, quickly clearing shelves of bottled water.
"It looked like Black Friday," said Aundrea Simmons, who stood in a line of about 50 people at a pharmacy before buying four cases of water. "I have children and elderly parents. They take their medication with water."
The city advised about 400,000 residents in Toledo, most of its suburbs and a few areas in southeastern Michigan not to brush their teeth with or boil the water because that would only increase the toxin's concentration. The mayor also warned that children should not shower or bathe in the water and that it shouldn't be given to pets.
Toledo issued the warning just after midnight after tests at one treatment plant showed two sample readings for microsystin above the standard for consumption.
Algae blooms during the summer have become more frequent and troublesome around the western end of Lake Erie, the shallowest of the five Great Lakes.
The algae growth is fed by phosphorous mainly from farm fertilizer runoff and sewage treatment plants, leaving behind toxins that have contributed to oxygen-deprived dead zones where fish can't survive. The toxins can kill animals and sicken humans.
Scientists had predicted a significant bloom of the blue-green algae this year, but they didn't expect it to peak until early September.
Gov. John Kasich's emergency order issued Saturday allowed the state to begin bringing water into the Toledo area. Large containers were being filled with water at a prison near Columbus and trucked about 130 miles north to Toledo, said Joe Andrews, a spokesman for the Ohio Department of Public Safety.
The state also asked major grocery chains to divert as much water as they can to northwest Ohio, Andrews said.
As truckloads of water came in from across the state, Toledo leaders set up distribution centers at schools around the city, limiting families to one case of bottled water. Some stores were receiving new shipments of water and putting limits on how much people can buy.
"We're going to be prepared to make sure people are not without water," said Toledo Mayor D. Michael Collins.
He said the city hopes to know Saturday night how long the warning will stay in place, and he pleaded with residents not to panic. There were no reports yet of people becoming sick from drinking the water, Collins said.
Sample of water were flown to the federal and state Environmental Protection Agency offices in Cincinnati and Columbus and a university in Michigan for additional testing, officials said.
Police officers were called to stores as residents lined up to buy bottled water, bags of ice and flavored water.
"People were hoarding it. It's ridiculous," said Monica Morales, who bought several cases of bottled water before the store sold out of water a half-hour after opening.
Stores in cities up to 50 miles away were reporting shortages of bottled water. Some neighboring communities that aren't connected to Toledo's water system were offering their water to people who brought their own bottles and containers.
Operators of water plants all along Lake Erie, which supplies drinking water for 11 million people, have been concerned over the last few years about toxins fouling their supplies.
Almost a year ago, one township just east of Toledo told its 2,000 residents not to drink or use the water coming from their taps. That was believed to be the first time a city has banned residents from using the water because of toxins from algae in the lake.
Most water treatment plants along the western Lake Erie shoreline treat their water to combat the algae. Toledo spent about $4 million last year on chemicals to treat its water and combat the toxins.
Have something to add to this story? Share it in the comments.
Topics: environment, Health & Fitness, Ohio, Pics, state of emergency, U.S., water
The rectangles represent active war game zones. In U.S. military history, this massive of a war game is unprecedented both in length and scope.
In the last article, I presented this map and posed the question, why would the military make a decided effort to keep our Navy in a permanent state of readiness by conducting unprecedented and an unparalleled set of war games continuously going on off of our three coastlines and several of our overseas territories? Guesses ranged from positioning the Navy, Marines and a fair amount of the Air Force off the coast to keep Americans from running if they are put in harms way when martial law is declared. Some believe that this has to do with preparing to begin World War III. These are all interesting guesses, however, they are not correct and the answer will surprise everyone as I know it surprised me.
These ongoing war games have angered much of the Congressional delegations of California, Oregon and Washington. When these representatives got wind of what was coming back in 2009, prior to the Environmental Impact Statement, they organized. In the Appendix section, listed below, I have included one of the letters of congressional protest. Ask yourself, one question, with several members of Congress opposing these massive ongoing war games that have now lasted for years, why wasn't this been reported on in the mainstream media? By the end of this article, you will be able to answer that question. In response to Congressional requests, NOAA was unwilling to intervene and stop the war games from going forward and these Congressman, now joined by Senators Boxer and Feinstein, approached the Secretary of the Navy, B. J. Penn, and he rejected their request out of hand as well.
The United States has the bulk of its land-based fighting units in Afghanistan which totals about 165,000 troops. Now we see a significant part of our Air Force and Navy engaged in this massive off shore exercise. Why? And another important question to be asking is whether or not, the ships and their subsequent military maneuvers are facing toward our coastlines or primarily away from them? We have some answers to these questions. First from the Congressional letter to NOAA, it is clear that their primary concern of these Congressmen is the presence of sonar based exercises:
''The sonar exercises at issue would take place off the Atlantic and Pacific coasts, Hawaii,Alaska and in the Gulf of Mexico '' affecting literally every coastal state. In manyregions, the Navy plans to increase the number of training exercises or expand the areasin which they may occur. Of particular concern are biologically sensitive marine habitats'...''
Sonar exercises? The U.S. Navy is not conducting sonar exercises beneath the ocean in preparing to fight ''sensitive marine'' inhabitants, at least they are not unless the Navy is preparing to fight sensitive marine inhabitants that contain submarines armed with nuclear weapons. The launch and detonation of a small number of nuclear weapons over the United States would unleash an EMP which would take down some, most or all of the grid. Most of the military's assets, save the nuclear weapons, are not hardened against an EMP attack of this nature. It was at this point that I had an ''AHA'' moment and I realized that the military was engaged in an act of self-preservation. The military is not preparing to kill whales, but they are prepared to thwart an EMP attack and at a minimum have enough of their fighting force offshore to be able to survive such an attack should it prove successful.The prime directive of any organization is survival and this is what we are seeing here.
In research, there is what you know and what you can prove. I have felt certain that I have known for over 20 months why these exercises are occurring. However, at best what I previously had was circumstantial speculation and two very well placed informants telling me that this is what is going on. Therefore, the rest of this article will piece together a significant amount of evidence, both direct and circumstantial, which confirms my belief that an EMP attack is coming.
Not everyone in the military is on board with this course of action and we have to look no further than to Benghazi, for the proof that much of our military leadership is not working hand in hand with this administration.
This Administration Survives Mutiny and a Possible Coup In a Potential War ZoneThe Middle East command structure of the American military is not presently, and was not on board with President Obama, Secretary of State Hillary Clinton and then Defense Secretary Leon Panetta at the time of Benghazi.
In the aftermath of the Benghazi massacre, two senior level command officers, General Carter Ham, the former commander of AFRICOM and Admiral Charles M. Gayouette, the Commander of Carrier Task Force 3, were removed from the command positions and arrested by their CIA Obama, embedded executive officers. They were arrested for disobeying a Presidential directive regarding the abandonment of Stevens at Benghazi as both military leaders were in the process of executing a coordinated rescue effort when they were arrested. The operational details can be read about here.
It is common knowledge that Obama has been embedding CIA operatives into the number two command positions in key military commands around the world. When Hamm was in the process of launching a rescue mission to save Stevens, General Rodriguez promptly arrested Hamm and assumed his position as the head of AFRICOM. The same happened to Gayouette. Why were these two military commanders so willing to risk their careers and lives to rescue Stevens? Because after Stevens was rescued and he had full knowledge that he was being set up to cover up the drug running, gun running and child sex trafficking, being used to financially support regime change activities in Libya and Syria. If rescued, Stevens might have publicly talked about what he knew and the factions running this country into the ground, might have been on their way to prison.
What are the odds that two senior military officers, whose positions are so sensitive that their replacements had to be approved of by the Senate, operating in a war zone, committing mutiny against the President of the United States and that their actions were confined to just the two sacked officers? The answer is that the chances were zero that they were working only concert with each other. It would be easier to defy the odds in winning the lottery than to believe that. There were others involved as well. Satellites had to be redirected as well as providing relevant intelligence information to the intended rescue. So, is it surprising that Obama has sacked over 260 senior command officers during his tenure? The Benghazi rescue was a military coup that failed. And let's not be naive enough to think that these two senior officers loved Chris Stevens enough to risk their careers to do what they did. This was about regime change and the top levels of military know what is coming and have deployed their assets accordingly.
My insider sources tell me that the only reason that the military has not gone from a condition mutiny to a military coup is that they do not feel that they have the popular support of the dumbed down population, at least for now. This is why we are seeing a gluttony of insider sources speaking to the alternative media in this critical information war where the belief system of the country, as a whole, is at stake.
There are more Obama moves which strengthen the validity of these observations. Within two months after the Benghazi attack, four very senior U.S. military officers were purged by Obama:
Gen. Hamm, on October 18, 2012.Adm. Gayouette, on October 18, 2012.Gen. Petraeus, on November 9, 2012.General Allen, on November 13, 2012.This event reminds me of when Hitler discovered he had been betrayed by General Irwin Rommel and other senior level German officers who attempted to assassinate Hitler. The Nazis killed these Generals and covered it up as war casualties. Obama politely retired our offending officers in disgrace. The deposed military senior command officer body count has reached over 260 officers removed by Obama.
GridEX II
On November 13th and 14th of last year, several of the alphabet soup agencies engaged in a war game in which the power grid was taken down by high altitude nuclear missile detonations in an exercise known as Grid EX II. On the surface, the drill seems like a great idea until one realizes that our two arch enemies, Russia and China were invited to participate, which made no sense.
We have been moving towards war with Russia and their ally China over Syria and Iran for two years in which both the Russians and Chinese have threatened to nuke us if we attack either nation. We are also seeing Doug Hagmann's confidential source stating that the path to war with these entities lies in the Ukraine. This is what MH-17 is about. It's about war with Russia and we are letting them in the backdoor.
Considering these facts, it makes no sense as to why Russian troops were allowed into the previous Grid EX II EMP attack drill, they have been used to police major events on American soil. This is martial law desensitization training in which the Russians are trained to interact with American citizens. FEMA signed a bilateral agreement with the Russian military to permit a minimum of 15,000 Russian soldiers to train on American soil and this is at a time when both Russia and China threatened to nuke the United States if we dared to invade Syria or Iran.
The following is a quote from the Russian Emergency Situations Ministry:
''The Russian Emergency Situations Ministry and the USA FederalEmergency Management Agency (FEMA) are going to exchange experts during joint rescue operations in major disasters. This is provided by a protocol of the fourth meeting of the U.S.-Russia Bilateral Presidential Commission Working Group on Emergency Situations and seventeenth meeting of Joint U.S.-Russia Cooperation Committee on Emergency Situations, which took place in Washington on 25 June.
The document provides for expert cooperation in disaster response operations and to study the latest practices. In addition, the parties approved of U.S.-Russian cooperation in this field in 2013-2014, which envisages exchange of experience including in monitoring and forecasting emergency situations, training of rescuers, development of mine-rescuing and provision of security at mass events.''
This is followed by letting the Russians and Chinese into the Grid EX II drill as well as the RIMPAC war games. Don't forget about the BLM document which introduces America to a new Agenda 21 land designation and it is called a ''Solar Energy Zone''..These zones are being handed over to the Chinese and has provided a means from which to bring in the future policing force of the United Nations.
An occupation force is being mobilized.
Let's not forget the backdrop of our present environment. The United Nations is establishing a foothold on our Southern border with Mexico. This administration is allowing a Fifth Column insurgency force (i.e. MS-13, the Sinaloa and Los Zetas drug cartels) into the country along with millions of unscreened immigrants who could be bringing large numbers of horrific diseases and viruses.
If this is not enough proof about what is coming, we must realize that every false flag event must have a beta test, and we have that as well.
Yemen
Yemen was the beta test
On June 9th, Israel National News Arutz Sheva reported that for the first time in history, a terrorist attack on the electric power grid has blacked-out an entire nation by taking down the grid. This was a beta test for what is coming to the United States.
The attack on Yemen's grid was brought to my attention by Dr. Peter Pry, a former CIA Intelligence Officer who has written and lectured extensively on the topic of threats to the U.S. power grid. Pry stated that he believed that this attack was a portend for what is coming to the United States. Remember Pry is CIA, and will always be CIA. So let's look at this as just another Operation Northwoods. This was a beta test for what is coming to the U.S. and what I have been told is that the military has prepared to survive this coming event. And we should all be saying thanks as the future UN occupation troops would have free reign if the military were to be totally taken down in such an attack.
In the Wall Street Journal, FERC chairman John Wellinghoff stated that a similar attack would ''Destroy nine interconnection substations and a transformer manufacturer and the entire United States grid would be down for at least 18 months, probably longer.''
Where is this headed? What are the available operational details? This will be the topic of the next part in this series.
APPENDIXMarch 12, 2009Protect Whales During Navy Training ExercisesDeadline April 3, 2009Dear Colleague:
Please join us in sending the attached letter to Jane Lubchenco, Undersecretary forOceans and Atmosphere for the Department of Commerce, expressing support for theNational Oceanic and Atmospheric Administration's review of measures that couldreduce harm to whales and other marine mammals from the Navy's use of mid-rangesonar.
The Navy estimates that its sonar training activities will ''take'' marine mammals morethan 11.7 million times over the course of a five-year permit. The scale of these exercisesand the vulnerability of protected species to sonar make it imperative that NOAAprescribe mitigation measures that will best protect marine mammals while still allowingthe Navy to train effectively.
For more information, or to co-sign the letter, please contact Jeb Berman (Rep.Thompson, 53311) or Rob Cobbs (Rep. Waxman, 54407).
Sincerely,MIKE THOMPSON
Member of Congress
HENRY A. WAXMAN
Member of Congress
March 12, 2009
Dr. Jane LubchencoUndersecretary for Oceans and AtmosphereDepartment of Commerce14th and Constitution Avenue, N.W., Room 5128Washington, DC 20230Dear Undersecretary Lubchenco:
On January 23, the National Oceanographic and Atmospheric Administration (NOAA)announced that it would conduct a comprehensive, 120-day review of measures to reduceenvironmental harm from the Navy's use of mid-frequency sonar in training exercisesand then report the results to the Council on Environmental Quality. We are writing toencourage and express our strong support for this review process.
The sonar exercises at issue would take place off the Atlantic and Pacific coasts, Hawaii,Alaska and in the Gulf of Mexico '' affecting literally every coastal state. In manyregions, the Navy plans to increase the number of training exercises or expand the areasin which they may occur. Of particular concern are biologically sensitive marine habitatsoff our coasts, such as National Marine Sanctuaries and breeding habitat for theendangered North Atlantic right whale. In all, the Navy anticipates that its sonarexercises will ''take'' marine mammals more than 2.3 million times per year, or 11.7million times over the course of a 5-year permit.Under these circumstances, it is essential that NOAA prescribe mitigation measures thatsubstantially reduce impacts on marine wildlife and habitat while allowing the Navy totrain effectively.
We are confident that NOAA's review will identify the mitigation measures necessary tominimize environmental impacts and improve monitoring of affected populations,including the establishment of seasonal or geographic sonar exclusion areas that scientistshave identified as the most effective available means of protecting vulnerable species andhabitat.We appreciate your consideration of this important matter, and your efforts to improvethe health of our oceans.
There is a big new 92 page Minority Staff Senate report on ''the Billionaires Club'' that funnels money through labyrinthine mechanisms and sophisticated tax loopholes to conceal the source of the funding.It is corruption all the way down'...
'...
The Chain of Environmental Command, (2014) United States Senate, Committee on Environment and Public Works, Minority Staff Report
''EXECUTIVE SUMMARY
'...an elite group of left wing millionaires and billionaires, which this report refers to as the ''Billionaire's Club,'' who directs and controls the far-left environmental movement, which in turn controls major policy decisions and lobbies on behalf of the U.S.Environmental Protection Agency (EPA). Even more unsettling, a dominant organization in this movement is Sea Change Foundation, a private California foundation, which relies on funding from a foreign company with undisclosed donors. In turn, Sea Change funnels tens of millions of dollars to other large but discreet foundations and prominent environmental activists who strive to control both policy and politics''
The donations are fed to a public charity (with tax benefits), which then forwards the money to a different linked type of organization which is permitted to lobby and campaign politically.
'''...what is clear is that these individuals and foundations go to tremendous lengths to avoid public association with the far-left environmental movement they so generously fund. The report attempts to decipher the patterns of ''charitable giving.'' Often the wealthiest foundations donate large sums to intermediaries '' sometimes a pass through and sometimes a fiscal sponsor. The intermediary then funnels the money to other 501(c)(3) and 501(c)(4) organizations that the original foundation might also directly support. The report offers theories that could explain this bizarre behavior, but at its core, the Billionaire's Club is not, and seemingly does not, want to be transparent about the groups they fund and how much they are supporting them.
Nearly all of the public charities discussed in this report have an affiliated 501(c)(4) that engages in activities designed to influence elections and have no restrictions on their lobbying efforts. The funding of a 501(c)(4) by a 501(c)(3) affiliates is provocative in light of the legal restrictions on public charities from participating in political campaigning, either directly or indirectly, while permitting a 501(c)(4) to significantly engage in campaign activities. (Pg. 14)In advancing their cause, these wealthy liberals fully exploit the benefits of a generous tax code meant to promote genuine philanthropy and charitable acts, amazingly with little apparent Internal Revenue Service scrutiny. Instead of furthering a noble purpose, their tax deductible contributions secretly flow to a select group of left wing activists who are complicit and eager to participate in the fee-for-service arrangement to promote shared political goals. Moreover, the financial arrangement provides significant insulation to these wealthy elite from the incidental damage they do to the U.S. economy and average Americans.
The ''green revolving door'' at the EPA uses your tax funds to reward activists with careers, who in turn send more taxpayer funds to friends and colleagues.
''The Billionaire's Club achieves many of its successes through the ''capture'' of key employees at EPA. These ''successes'' are often at the expense of farmers, miners, roughnecks, iismall businesses, and families. This report proves that the Obama EPA has been deliberately staffed at the highest levels with far-left environmental activists who have worked hand-in-glove with their former colleagues. The green-revolving door at EPA has become a valuable asset for the far-left and their wealthy donors. In addition to providing insider access to important policy decisions, it appears activists now at EPA also funnel government money through grants to their former employers and colleagues. The report tracks the amount of government aid doled out to activist groups and details a troubling disregard for ethics by certain high powered officials.''
Under President Obama, EPA has given more than $27 million in taxpayer-funded grants to major environmental groups. Notably, the Natural Resources Defense Council and Environmental Defense Fund '' two key activists groups with significant ties to senior EPA officials '' have collected more than $1 million in funding each. (Pg. 34)Is this where the fantasy of ''organized networks of skeptics'' comes from? Those bizarre spaghetti diagrams with tenuous links are just a ''projection'' of the real organized networks of lobbyists and activists.
I expect we'll be discussing the details for some time to come. I have no problem with anonymous donors to real charities, but tax dodging, fake grassroots movements, coupled with political influence, and ultimately amplification through government funds is something else.
Why are some groups allowed to get away with what appears to be a form of tax evasion? Is this selective enforcement (like the IRSScandal), or can any side of politics get away with it?
VN:F [1.9.22_1171]
Rating: 9.4/10 (57 votes cast)
Senate Report: Billionaires covertly funding environmental machine, 9.4 out of 10 based on 57 ratings
WASHINGTON (Reuters) - Energy taxes in much of the world are far below what they should be to reflect the harmful environmental and health impact of fossil fuels use, the International Monetary Fund said in a new book on Thursday.
For the first time, the IMF laid out exactly what it views as appropriate taxes on coal, natural gas, gasoline and diesel in 156 countries to factor in the fuels' overall costs, which include carbon dioxide emissions, air pollution, congestion and traffic accidents.
Under its chief, Christine Lagarde, the IMF has delved into the impact of climate change, arguing that tackling the fund's core mission of economic instability is impossible without also addressing environmental damage.
At the book's launch in Washington, Lagarde said countries should not have to wait for global agreement on climate policies, and instead should move ahead in adjusting energy prices on their own.
Nations are now working on a United Nations deal for late 2015 to rein in greenhouse gas emissions that have hit repeated highs this century, but progress has been slow as nations fret about the impact any measures could have on economic growth.
The IMF's book argues higher energy taxes should not hurt growth if done right.
"On this point, let me be crystal clear: we are generally talking about smarter taxes rather than higher taxes," Lagarde said, according to prepared remarks for the launch of the book.
She said higher energy taxes are the most efficient and simple way of dealing with environmental harm and would allow governments to stop relying on a "patchwork" of other uncoordinated policies to deal with climate change, such as subsidies for renewable energy.
Higher energy prices would prompt people to shift to cleaner fuels or more fuel-efficient vehicles on their own, Lagarde said, adding that they could also allow governments to lower other taxes on consumption or income to reduce the burden on people, or pay down more public debt.
The IMF estimates implementing efficient energy taxes would reduce deaths from fossil fuels by 63 percent, cut carbon emissions by 23 percent, and raise revenues by 2.6 percent of GDP for the world as a whole.
The IMF has made a big push in recent years for countries to rein in energy subsidies, which it says hurt the environment while rarely helping the most vulnerable and eating up valuable government funds that could be put to better use elsewhere.
"But we need to go well beyond the elimination of direct cash subsidies, and make sure that energy tax systems around the world properly reflect environmental side effects," Lagarde said in prepared remarks for the event on Thursday.
(Reporting by Anna Yukhananov; Editing by Paul Simao)
As temperatures rocket health warnings have been issued[GETTY]
The country will bake in temperatures well above the July average for at least another week.
The weather has already claimed the lives of eight people, who have drowned after swimming in rivers and open waters to cool off.
Now experts have warned elderly and vulnerable people to take extra care during the extreme heat.
Malcolm Booth, for the National Federation of Occupational Pensioners, said: ''Excess winter deaths, which run into tens of thousands, feature every year.
''This year we might face equally alarming statistics as the heatwave continues with increases in deaths particularly among the elderly.
''Everyone should heed the warnings '' and family, friends and neighbours should regularly check on those most vulnerable.''
The start of August looks likely to bring a transition towards less settled conditions, with widespread rain or showers in the North. But it will remain on the warm side
Forecaster Dan Williams
The Met Office cautioned that temperatures in the South will stay in the high 70s this week '' with the North also warmer than normal.
Forecaster Dan Williams said: ''The start of August looks likely to bring a transition towards less settled conditions, with widespread rain or showers in the North. But it will remain on the warm side.''
Jonathan Powell, forecaster for Vantage Weather Services, said Britain should be braced for further extreme ''heat spikes''. He said the mercury could rocket above the year's high of 90.1F (32.3C) recorded in Gravesend, Kent.
Leon Brown, from The Weather Channel, said it will hit 81F in the South by the end of this week.
Raging temperatures have continued to fuel a frenzy of betting with bookmakers.
Coral has slashed odds from 7-1 to 5-1 that the record is broken for the highest recorded temperature '' of 101.3F at Faversham, Kent, in August 2003.
Police are urging swimmers and divers to take extra care. After the death of a man in North Tyneside, Chief Superintendent Kay Blyth said: ''Open water can be extremely deceiving with powerful currents and tides and obstructions under the surface.'' The man, in his 40s, jumped into the Fish Quay in North Shields on Saturday.
Related articlesHis death came a day after a 61-year-old man died while retrieving a ball from Blue Lagoon lake, near Bletchley, Bucks. Also, a man of 60 died of a suspected heart attack while diving with seals off Lundy Island in the Bristol Channel. Last week, six young people died in rivers and lakes.
A nine-year-old was ''very poorly'' last night after beig dragged unconscious from near Tinker Bridge waterfall in Keighley, West Yorks.
lHundreds of people could spend three days without luggage after delays at Gatwick caused by staff shortages at baggage handling firm Swissport. Officials said arrangements were being made to send bags to people's homes.
I heard the last show (Thur, 31 July 2014). Here is the latest campaign slogan, Man of the People. Notice the Obama-like circle thing. I swear that all the major parties here have American consultants.
I met an independent pollster in İstanbul. He said that among the voters in Turkey, they watch MORE tv than any other population in Europe and something like 80% of Turks get their news directly and only from State-run TV stations.
The pollster said that Eroğan has more media control than Berlusconi did in Italy.
As far as I can tell, the Türk masses like the fact that the ruling party, AKP, are criticizing the Gülenists. At the same time, the AKP is showing off their pro Islamist colors, by catering to any and all socially, pro Muslim ideals.
Lastly, I am leaving - this week. Maybe we will move to Istanbul in the fall of 2015.
FEMEN Turkey was the latest participant of the protest that spread on social media.
Turkey's Deputy Prime Minister B¼lent Arın§ has defended his claim that his recent criticism against women ''laughing'' was interpreted out of context, while slamming women ''who go for a vacation with their lovers while leaving their husbands behind and can't wait to climb poles when they see one.''''My speech was not just about a few reminders for women; it was targeting men, too,'' Arın§ said while answering public broadcaster TRT Haber's questions on July 30.
Speaking during an Eid al-Fitr meeting on July 28, Arın§ described his ideal of the chaste man and woman, saying they should both have a sense of shame and honor.
''Chastity is so important. It is not only a name. It is an ornament for both women and men. [She] will have chasteness. Man will have it, too. He will not be a womanizer. He will be bound to his wife. He will love his children. [The woman] will know what is haram and not haram. She will not laugh in public. She will not be inviting in her attitudes and will protect her chastity,'' he had said, sparking a heated debate.
On July 30, Arın§ defended his words, saying the speech took some 1.5 hours, but complained that ''some people pick a section of it and criticize'' it.
''I stand by my words,'' Arın§ said, arguing that urging just women to not laugh is ''irrational,'' but his speech was about ''general rules of ethics and good manners.''
''There are some artists who now laugh artificially and send me their photos. Real laughs relieve a person, but these are artificial ones. Those who go for a vacation with their lovers while leaving their husbands behind and can't wait to climb poles when they see one,'' Arın§ added.
Arın§ did not name any names, but Asena Erkin, wife of Fenerbah§e footballer Caner Erkin, had recently shared a photo on her Instagram account, reading, ''When I find a [dancing] pole, I never miss the chance.''
Asena Erkin had also reportedly gone for a vacation with a pop singer while her husband remained in Turkey last year.
Arın§'s controversial remarks had sparked a social media protest with hundreds of women in Turkey posting photos that show them laughing, shared under the hashtags #kahkaha (laugh) and #direnkahkaha (resist, laugh). Over 300,000 tweets were posted for the campaign, according to BBC Trending.
FEMEN Turkey was the latest participant of the protest, claiming in a tweet that ruling Justice and Development Party (AKP) officials ''can keep crying on TVs to deceive people, but women will keep on laughing.''
''You can live such a life. Instead of being angry at you, I only feel pity for you,'' Arın§ told TRT Haber.
''I personally think the act of adultery shouldn't be committed and I condemn it,'' he added.
July/30/2014
PHOTO GALLERY
Turkish court considers wearing leggings as 'provocative' factor in domestic violence case - CRIME.
According to an opposition statistic, 129 women were killed in the first half of 2014, compared to 88 in the same period a year earlier.
A local court in the eastern province of Erzurum has reduced the sentence of a husband who attacked his wife after seeing her with another man, arguing that her wearing leggings and sitting ''slightly leaning to one side'' could be described as ''provocative'' and an extenuating circumstance.T.K., who seriously injured his wife, D.K., by stabbing her during a row after seeing her in the same car with another man, was eventually handed six years and three months in prison after his sentence was reduced.
Prosecutors had asked for up to 15 years in prison on charges of attempted homicide; the couple admitted that they were seeking a divorce when the incident occurred.
Defense lawyers denigrated D.K., arguing that she provoked the husband's anger by sitting in the backseat of the car while wearing leggings and leaning toward one side. T.K. also said he only intended to scare his wife when he pulled the knife.
But D.K. rejected her husband's accusations, claiming that the man in the driver's seat, A.P., was a friend of 14 years and that her husband saw them at a gas station while they were going to pick up her brother and sister.
''I wasn't wearing anything bawdy, as he claims. He asked me 'Why did you leave me?' when he entered in the car and stabbed me. Then he said: 'I told you I would kill you. Now it will be your family's turn,''' D.K. told the court.
However, in its ruling, the court lent credence to the husband's argument that D.K. appeared ''very comfortable'' inside the car, saying her attitude was ''suspicious'' and ''provocative.''
The latest incident comes amid increasing cases of domestic violence and murders of women in Turkey. According to an opposition statistic, 129 women were killed in the first half of 2014, compared to 88 in the same period a year earlier.
The property was reportedly purchased by King Abdullah in 1984. DHA Photo
Istanbul's Sevda Tepesi (Love Hill), which has belonged to the king of Saudi Arabia since 1984, has returned to the agenda after the main opposition said a construction permit for the hill was granted only after Saudi Arabia sent $100 million to a charity that counts the prime minister's son as one of the board members.Republican People's Party (CHP) deputy Sezgin Tanrıkulu submitted a parliamentary question yesterday asking if the Service for Youth and Education Foundation of Turkey (T'RGEV), a charity NGO that includes Bilal ErdoÄan, son of Prime Minister Recep Tayyip ErdoÄan, among its board members, had received $99,999,900 donation in its account at Vakıfbank on April 26, 2012, in return for a construction permit for Saudi King Abdullah's plot of land on the shores of the Bosphorus.
The permit was given only two months after the money transaction sent by chief of the Royal Protocol, which conducts protocol and agreements for the king, the CHP deputy added.
Deputy Prime Minister B¼lent Arın§ confirmed at the time that T'RGEV had received $99,999,900 in aidfrom abroad between 2008 and 2012.
Tanrıkulu also asked if the king had formally applied for the permission to conduct construction and, if so, its date, as well as why the permit was not given.
The property was reportedly purchased by King Abdullah in 1984.
Militant Islamist fighters take part in a military parade along the streets of northern Raqqa province June 30. REUTERS PHoto
The jihadist Islamic State has imposed a strict dress code for women in eastern Syria, forbidding them from showing any part of their bodies, a monitoring group said on July 31."Women... are completely forbidden from showing their eyes," said the statement, which the Syrian Observatory for Human Rights said was distributed in IS-controlled areas of Deir Ezzor province in the east.
Women are also forbidden from wearing "open abayas (traditional black gowns) that reveal colourful clothes worn underneath", it said.
Abayas, it added, "must not be decorated with beads, sequins or anything else" and women "must not wear high heels."
"Anyone who violates this will be penalised," it added, without elaborating on the punishment. Last month, IS declared the establishment of an Islamic "caliphate" straddling Syria and Iraq.
The group has been accused of committing some of the worst atrocities in Syria's more than three-year war, including mass kidnappings and summary executions.
In parts of Deir Ezzor city that are under jihadist control, the group also distributed a statement forbidding the sale and public use of nargileh (water pipe) tobacco and cigarettes, the Observatory said.
"In its effort to implement Islamic law and to fight evil things, it is completely forbidden to sell cigarettes and nargileh anywhere," it said, citing the jihadists who also forbade "smoking in public."
IS first emerged in Syria's war in late spring last year.
It has taken over large swathes of formerly opposition-held areas, after fighting rebels seeking President Bashar al-Assad's overthrow.
In recent weeks, it has fought on multiple fronts against regime troops, rebels including Islamists, and Kurdish fighters.
July/31/2014
PHOTO GALLERY
Turkey Fears ISIL Radicalism Could Spill Over From Syria, Iraq.
(VOA) -- With the Sunni jihadist group ISIL stepping up attacks in Syria along the border with Turkey, concern is growing in Turkey that the violence could spill over.
Earlier this month, Istanbul's Jafari Muhamadiye Mosque a mosque belonging to Turkey's Shi'ite Muslim minority was burned down. The attack was blamed on ISIL and is seen as a possible harbinger of future ISIL attacks, which could threaten Turkey's complex social fabric.
Istanbul is home to large numbers of adherents of both Sunni Islam and Shi'ite Islam -- or Jafari Islam, as the latter is known in Turkey. But tensions between the two groups have been rising following the arson attack.
Speaking in the burned out ruins of his mosque, Imam Hamza Aydin said he has no doubt sectarianism was the motive for the attack.
Aydin said that just before the attack, a group of men came to the mosque, and said that Jafaris "worship stones" and threatened to set fire to the mosque.
He said mosque authorities went to the police, but they did nothing.
Turkey's neighbors Iraq and Syria have seen growing sectarian strife between Sunnis and Shi'ites, blamed mainly on the emergence of ISIL, which now calls itself simply the Islamic State. The group regards Shi'ites as heretics.
Analyst Sinan 'lgen of the Carnegie Europe Institute in Brussels said fears are growing that ISIL's sectarian war is coming to Turkey,
"There are allegations that some members of a network that claim to be close to ISIL have engineered this," 'lgen said. "Some of these militants groups have been able to establish their networks over the years, at the time the Turkish government turned (a) blind eye to many of these opposition groups. It just shows you Turkey is not going to be safe from all the instability from Syria."
Turkey's ruling Islamist-rooted AK Party is one of the main supporters of the rebel groups fighting the Syrian regime. The arson attack on the Istanbul mosque has not been the only such incident. Shi'ites in Istanbul claim they have been the target of increasing sectarian violence.
A shopkeeper in one of Istanbul's Shi'ite neighborhoods said that recently, a man shouting he was from ISIL starting attacking Shi'ites outside another mosque in Istanbul.
Electoral politics could be also be a factor behind the rising tensions. Prime Minister Recep Tayyip Erdogan is running for president in next month's elections, and he is rallying his largely conservative Sunni religious base. Critics accuse him of increasingly using sectarian language aimed at Shi'ites. He also resisted calls in the media and from Shiite groups to condemn the Istanbul mosque attack.
But Mehmet Gomez, head of the Diyanet, the state body that administers the Islamic faith in Turkey, did visit the burned out mosque
"We will rebuild the mosque together," he said at the site of the mosque. "We are all Muslims, we use Korans and mosques. We will replace the burned books in the best possible way together, he said, and then we will gather here again and pray together."
Observers say such gestures could prove crucial amid rising tensions and concerns over the growing danger of radical groups like ISIL.
Still, ISIL flags and bandanas are increasingly visible at protests organized by Islamic groups, indicating that at least some Sunnis in Turkey have sympathy for the group. Analysts warn that ISIL's increasing presence is likely to test the cohesiveness of Turkish society.
Turkish deputy PM concerned over growing Syrian refugee population
A Syrian woman begs with her children downtown Istanbul on July 16. AFP Photo / B¼lent Kılı§.
Deputy Prime Minister BeÅir Atalay has sought to allay widening concerns over the growing number of Syrian refugees begging on streets as well as over the cheap labor force provided by the refugees, while calling on provincial administrations to deal with the issue, via assistance from civil society if necessary.Recalling that Turkey has so far built 22 camps mostly in provinces close to the border with Syria to host refugees fleeing the ongoing civil war, Atalay said Aug. 1 and noted that the camps were currently hosting 220,000 refugees and that there was space in camps for 30,000 more people.
''The data that we have for the moment concerning the [refugee] population outside of the camps is 1,104,000 people,'' Atalay said, speaking at a joint press conference with Fuat Oktay, the president of the Prime Ministry's Disaster and Emergency Management Directorate (AFAD).
''We are still trying to register all of these [people]. Those housed in camps are all registered, and around 60 percent of those outside the camps are also registered,'' Atalay said.
Acknowledging that conditions have been forcing some of the refugees to beg on streets, Atalay particularly underlined that there was still space in camps. They also sent a related circular to governors, he said, without elaborating on the content of the circular.
''We still have vacant places in our camps. Do not allow scenes like begging. Civil society organizations there can also help these [people]. But if you send them to camps, we have vacant places. We can build new camps too, we are looking for venues. We don't want such scenes for our Syrian siblings,'' Atalay said.
When reminded of allegations that some business owners have been employing Syrian refugees as a cheap labor force and asked whether the government had any plan to deal with the situation, Atalay responded in the negative. ''So far, the government hasn't taken any decision on this issue. That's to say, we didn't have any practice of granting a collective or partial work permit,'' Atalay said.
As Turkey struggles with the influx of over a million refugees, the hospitality of locals is starting to wear thin. Syrian beggars have become increasingly visible in Istanbul, including women and young children, passports in outstretched hands, tapping on car windows in the city's dense traffic.
They represent a tiny fraction of the Syrians sheltering in Turkey, some housed in well-equipped camps along the border, others living with friends or family or in modest rented accommodation in cities in the southeast, Ankara or Istanbul.
But what feels like a growing number are living in derelict buildings or sleeping in parks, eking out a living by begging '' illegal in Istanbul '' and raising the concerns of locals and other Syrians trying to integrate seamlessly into Turkish life.No delay in resolution process
Meanwhile, Atalay also stated that by the end of summer, the government aims at completing a ''roadmap'' for the revival of the stalled peace process with the outlawed Kurdish Workers' Party (PKK), adding that the more ''concrete'' roadmap would include exact deadlines.
According to Atalay, different segments of society have embraced a reform bill which went into force in mid-July. Atalay was referring to the bill which gives a legal framework to the government-led peace process with the PKK.
''It will not be delayed,'' Atalay said, referring to the peace process which the government prefers to call a resolution process. ''During the summer, we will complete our roadmap,'' he added.
Beirut, Lebanon - Syrian government troops reportedly retook the Shaar gas fields in Homs province on July 26, a week after the facility was captured by Islamic State fighters, in what many view as an alarming increase in hostility between the group and the Syrian regime.
Footage distributed by Syrian state media showed victorious government troops celebrating atop tanks in what an official Syrian army statement described as a "precise operation in which dozens of terrorists were killed".
Islamic State sources later claimed that its fighters only pulled out after destroying the gas field's equipment and plundering at least 15 tanks and dozens of rockets used to guard the facility.
The incident is the latest in an escalation of tensions between Islamic State and the Syrian regime. The opposition-aligned Syrian Observatory for Human Rights said that fighting between the two has left over 1,100 soldiers and pro-government fighters dead in the last month.
SpotlightIn-depth coverage of escalating violence across Syria
Critics, including the FSA, claim the two groups have largely avoided direct confrontation in Syria's civil war, but clashes have become more frequent as the Islamic State group's military and financial strength increases.
"[The Islamic State group] is now looking to centralise and and stabilise its position. They are looking for financial sustainability and oil and gas can provide this. Their methods are quite sophisticated, almost professional," said Sami Nader, a professor of economics and international relations at Beirut's Saint Joseph University.
"In some cases during assaults [the Islamic State group] has been careful to avoid damaging the infrastructure of refineries. In the fields they are said to have tried to assure some workers of their jobs and safety."
RELATED: Syrian army retakes gas field from fighters
Since the beginning of June, Islamic State has emerged from its base in eastern Syria, seizing Iraq's second largest city, Mosul, and advancing down the Euphrates to the gates of Baghdad. The group's total assets are purported to total $2bn.
The seizure of American military equipment including trucks, Humvees, rockets, artillery pieces, and Stinger missiles from the Iraqi army has provided a fortuitous windfall.
The ranks of the group have also been bolstered by converts to the cause: A number of al-Nusra Front groups in Deir Ezzor and elsewhere are now said to pledge allegiance to Islamic State leader Ibrahim al-Baghdadi, in addition to several factions affiliated with the Free Syrian Army (FSA). These include the Daoud Brigade, based near Idlib, which pledged allegiance to Islamic State in January.
But accrued oil and gas assets represent an even bigger prize. While Syria's official oil production has dropped by 96 percent since the outbreak of war in March 2011, rebel groups have cashed in. Islamic State is currently said to control around 35 percent of Syria's territory, including nearly all of the country's oil and gas fields, which are predominantly in the east of the country.
Rebel-produced crude has largely been channeled through Manjib, north of Aleppo, onto Turkey, Iraq, Iran, and Jordan and sold for between $20-40 per barrel, compared to global market prices of $100. The revenues are said to net the Islamic State in the region $100m per month.
Further advances have been made towards the Baiji oil refinery, Iraq's largest, south of Mosul. Earlier in July, before the assault on Shaar, the Islamic State took control of the Omar gas fields in Raqqa from the al-Nusra Front.
Omar Abu Leila, a spokesman for the FSA's operations in eastern Syria, said that the Islamic State attack on Shaar was an unusual confrontation between the group and the Assad regime.
"Even when the regime claimed that they had shelled an Islamic State checkpoint, it has merely been media propaganda to obtain legitimacy from the international community," said Abu Leila, adding that any substantial FSA campaign against Islamic State and Raqqa in Deir Ezzor is impossible due to a lack of firepower.
IN PICTURES: Ramadan in Aleppo
The attack on Shaar represents an anomaly for another reason: Islamic State has made most of its profits through the sale of crude oil, while Shaar is a natural gas plant. Exploiting its resources for financial gain would have posed considerable problems for the organisation since the facility is connected through pipelines to regime-controlled territory.
"There is no easy way of sending the gas [from Shaar] anywhere else '... you can't put it in a tanker. If you wanted to send it somewhere else you'd have to build a whole new pipeline and that is not feasible," said David Butters, an energy expert and associate fellow at Chatham House.
Western intelligence sources have previously alleged that the regime of Bashar al-Assad had bought oil from both Islamic State and the al-Nusra Front in Deir Ezzor. However, given recent events, the regime's reaction at Shaar appears to illustrate an unwillingness to allow Islamic State to take control of further territory and resources, Butters explained.
There have been some local agreements between the regime and rebel groups concerning exchanging fuel and electricity but nothing on a large scale
- David Butters, energy expert, Chatham House
"There have been some local agreements between the regime and rebel groups concerning exchanging fuel and electricity, but nothing on a large scale," he told Al Jazeera. "Shaar looks like it could be a turning point because any effective understanding between the two is going to come under strain."
Prior to 2011, government income from oil constituted around 20 percent of the Syrian state's total budget revenue. This source of income has been almost totally eliminated by sanctions barring exports to Europe, and the loss of refineries to rebel groups, particularly in the east of the country.
But the government has been able to rely on the Banias refinery in northwest Syria in addition to considerable foreign support to meet its energy needs; both from Russia, and from Iran, who in 2013 reached an agreement with the state-owned Bank of Syria to provide $3bn worth of credit to cover oil supplies, as part of an overall lifeline of up to $7bn.
Seventeen million barrels of crude were shipped to Banias between February and October 2013, on credit from Iran, via the Sumed pipeline that runs through Egypt, according to one Reuters report.
Still, the growth of the Islamic State has undoubtedly raised alarm bells in Damascus. "New borders are being established, there has been a real change taking place in the last couple of weeks," said Sami Nader of Beirut's Saint Joseph University.
"If one follows the theory that the regime gave birth to Islamic State to further their own political agenda then the genie is well and truly out of the bottle."
Syrian sniper in Aleppo, Syria in mid-2013. Youtube screencap/Wikipedia photo
by Robert Beckhusen. Robert Beckhusen is a freelance writer who contributes regularly at War is Boring. He's also written for publications including C4ISR Journal, Wired, The Daily Beast and World Politics Review. You can follow him on Twitter.
The Islamist terror group ISIS's big advantage is that it doesn't fight conventionally. It's held off the regular army of Bashar al-Assad and routed thousands of Iraqi troops. But now a group has emerged that turns ISIS's tactics back against them.
The group is called White Shroud. There's very little known about the group, but Syrian citizen journalism website Tahrir Souri reported on the group's existence on July 24. According to the report, White Shroud is based in Abu Kamal near the border with Iraq, and the organization is associated with Syria's melange of rebel forces, not the Assad regime.
It's tactics include ''secret assassinations, raids and surveillance'' of ISIS targets, according to the report. The group uses improvised explosive devices, and stages attacks on ISIS gatherings at a distance with silenced sniper weapons. It also engages in kidnapping. Notably, these tactics are not dissimilar from those used by ISIS.
ISIS forces captured Abu Kamal in early July after pitched battles with ''opposition battalions and the Al-Qaeda-affiliated Al-Nusra Front terrorist group,'' reported Tasnim News. Whether White Shroud is affiliated with Al-Nusra or other opposition groups is unclear.
But there's plenty of reasons for those living under ISIS rule to take up arms against it. As the New York Timesdetailed in a report from ISIS-controlled Raffa in northern Syria, life under the terror group is hardly charitable. Law and order coexists with threats and the public amputation of the hands of alleged thieves. Women in particular are subject to severe dress codes (see also Christian Caryl, ''9 Things to Avoid When Creating Your Own Caliphate'', Foreign Policy, 29.07.2014).
If White Shroud's tactics at all sounds like terror, it is. Adversaries as extreme as ISIS '-- and use non-conventional tactics that make them difficult to uproot and defeat '-- lead to innovation and the development of counter-tactics among their opponents. One famous example is the U.S. recruiting Sunni tribesmen to fight Islamic State in Iraq forces during the Anbar Awakening '-- by essentially bringing the very communities under siege into the fight.
ISIS forces execute unarmed Iraqi prisoners in mid-2014. YouTube screencap
There are other examples. During the worst years of Colombia's cocaine-fueled violence in the early 1990s, the vigilante group Los Pepes emerged to conduct a covert war of assassination against associates '-- and family members '-- of drug lord Pablo Escobar's Medelln Cartel. These vigilantes were tacitly supported by Colombian law enforcement. Likewise, Mexico has seen a surge in anti-cartel vigilantes operating outside the control of the state security services.
An insurgent group can blend in and avoid detection from a conventional army, which is relatively easier to detect compared to the insurgent group. But an insurgent group faces similar difficulties fighting another group that flips its own tactics around. While ISIS's opponents might not be overtly comfortable with a shadowy group assassinating the jihadis with silenced weapons at a distance '-- what comes around, goes around. But as has been seen in other conflicts, covert violence against the bad guys can often mutate into something worse. Leaders of Los Pepes in Colombia later went on to lead death squads from the country's right-wing United Self-Defense Forces. Even ISIS initially sprouted up to fight the Assad regime, alongside rebel groups supported by the West.
Tahrir Souri reports White Shroud plans to extend its operations beyond Abu Kamal. That will make the difference between just harassment and a serious threat like the Awakening or Los Pepes.
Every so often, people who don't really understand the importance of anonymity or how it enables free speech (especially among marginalized people), think they have a brilliant idea: "just end real anonymity online." They don't seem to understand just how shortsighted such an idea is. It's one that stems from the privilege of being in power. And who knows that particular privilege better than members of the House of Lords in the UK -- a group that is more or less defined by excess privilege? The Communications Committee of the House of Lords has now issued a report concerning "social media and criminal offenses" in which they basically recommend scrapping anonymity online. It's not a true "real names" proposal -- as the idea is that web services would be required to collect real names at signup, but then could allow those users to do things pseudonymously or anonymously. But, still, their actions could then easily be traced back to a real person if the "powers that be" deemed it necessary. Here's the key bit:From our perspective in the United Kingdom, if the behaviour which is currently criminal is to remain criminal and also capable of prosecution, we consider that it would be proportionate to require the operators of websites first to establish the identity of people opening accounts but that it is also proportionate to allow people thereafter to use websites using pseudonyms or anonymously. There is little point in criminalising certain behaviour and at the same time legitimately making that same behaviour impossible to detect. We recognise that this is a difficult question, especially as it relates to jurisdiction and enforcement.
The report notes that the findings are "tentative" and that these recommendations might possibly "be an undesirably chilling step towards tyranny," but they don't seem that concerned about it, or they wouldn't have made the general recommendation in the first place.There is a long list of problems with such a proposal, beyond the obvious questions of how you would possibly enforce it and what the various chilling effects would be. But let's take it one step further and note the fallacy of the very premise made in the report: that without such requirements it is "impossible to detect" who did an action online deemed to be illegal. We've been dealing with this issue forever. A decade ago, we reported on the various freakouts over open WiFi and how it would "allow" anyone to commit crimes online and make it "impossible" to find them. And yet, time after time, we noted examples of basic detective work allowing police to track down the criminals.
Yes, without being forced to first identify yourself, it might make the police work a bit more difficult, but never impossible. Take a similar situation in the physical world. Anyone can walk into a store or a bank and hold it up. And they can do it without identifying themselves at the door before coming in. It happens all the time. Police have no official identity to work with, but they do have other clues -- fingerprints, video, photos, the clerk's memory -- to work off of and can piece together who committed the crime. The same is true of people online. Even if they don't identify themselves upfront, they frequently leave plenty of clues that allow law enforcement to figure out who they are.
So the very premise that this is somehow necessary is pretty much eliminated. Then combine it with all of the downsides that we already know about: chilling effects, the end of important anonymity, potential privacy violations and leaks and more. What you're left with is a horrible idea all around.
Scrap anonymity at web service sign-up, UK Lords advise '-- Tech News and Analysis
Jul. 29, 2014 - 7:10 AM PDT Jul. 29, 2014 - 7:10 AM PDT
It would be ''proportionate'' for the U.K. to demand that web services establish their users' real identities, a House of Lords committee has said.
The Communications Committee issued a report on Tuesday covering a range of issues around social media, such as trolling, bullying and revenge porn. The report was drawn up fairly quickly and, as such, the peers described their opinion as ''tentative'' '' broadly speaking, they said existing British laws against harassment and malicious communications seemed to be sufficient for policing the online world.
However, on the issue of anonymity they had this to offer:
''From our perspective in the United Kingdom, if the behaviour which is currently criminal is to remain criminal and also capable of prosecution, we consider that it would be proportionate to require the operators of websites first to establish the identity of people opening accounts but that it is also proportionate to allow people thereafter to use websites using pseudonyms or anonymously. There is little point in criminalising certain behaviour and at the same time legitimately making that same behaviour impossible to detect.''
In fairness, they also said there would be problems around jurisdiction and enforcement, and acknowledged that there was also a slippery-slope risk: ''Would this be an undesirably chilling step towards tyranny, or merely a necessary administrative step to ensure that law enforcement agencies can properly investigate crime?''
Real names aren't as much of an issue around revenge porn '' it's generally obvious where the pictures come from '' but they are relevant to trolling and bullying.
Here, as always, it's important to remember that the U.K. has strict libel and defamation laws that override the right to free expression. And that's where those jurisdictional problems haunt the debate, as the services we're talking about '' mainly Facebook and Twitter '' are based in the free-speech-first U.S.
University of Strathclyde Professor of Internet Law Lilian Edwards, who gave advice to the committee, told me that requiring real names at sign-up would be ''a dangerous, illiberal and stupid policy.'' This is partly because American sites would never agree to it, even if an attempt was made through the U.K. courts, but also because it would be unenforceable '-- even in the U.K.
''We have no online passport,'' Edwards said. ''[There's] no way consumers could reasonably be expected to reliably identify themselves in a way proportionate to any gains in justice efficiency.''
Edwards also pointed out that state real-name policies, usually associated with authoritarian regimes such as that in China, didn't have a great track record. ''South Korea's was a complete disaster, caused a giant security breach and was struck down as unconstitutional by its Supreme Court,'' she noted.
Thankfully this Lords report is only intended as advice for Parliament, and is not the official first step on any new legislative process.
Published time: July 31, 2014 15:33Reuters / Lucas Jackson
'A leading cancer hospital is to be investigated following allegations that one of its staff members exchanged human body samples for whisky and cash.
The calls to investigate Christies NHS foundation trust came after the accusation was made by an anonymous whistleblower, prompting British MP Rosie Cooper to contact the watchdog, the Human Tissue Authority (HTA), the Manchester Evening News reports.
British MP Rosie Cooper has also written to the government's health secretary Jeremy Hunt, describing the whistleblowers' claims as ''serious and grave''.
''The allegation tissue samples were sold without patients' permission if proven will bring shame on the NHS. The idea that individuals have allegedly profited from these sales, again if proven, would be abhorrent,'' the daily cited her as saying.
"It is important that no stone is left unturned in this investigation and for no allegation to be ignored''.
The Manchester based hospital and fiercely denied the allegations, stating that there is no evidence to suggest it made profits out of patients' personal information.
"We have been open and transparent since these concerns were first raised and we believe there is absolutely no truth in these allegations at The Christie" a spokesperson said.
This is not the first allegation of misconduct directed at the hospital, which is also the largest cancer centre in Europe, treating around 40,000 patients per year.
Complaints made by whistleblowers include accusations of financial mismanagement made by senior managers, such as a former chief executive using hospital funds to pay for a trip to Ibiza, and compensation paid to a member of staff who accused their bosses of 'false imprisonment'.
Monitor, along with the Care Quality Commission watchdog have met with the whistleblowers, and are to visit The Christie in the coming weeks.
Earlier this year whistleblower Sandra Haynes Kirkbright risked losing her job after raising fears that the Royal Wolverhampton Hospital were manipulating its death figures.
The incident prompted the health secretary to call for greater protection for NHS whistleblowers.
A major inquiry conducted by the US Justice Department (DOJ) and the Federal Bureau of Investigation has found hundreds instances in which FBI forensic units charged with gathering data on cases involving violent crimes provided false information. The doctored FBI lab reports led to the imprisonment of thousands of innocent people, some of whom were executed, according to a report Wednesday in the Washington Post.
The newspaper reported, ''Nearly every criminal case reviewed by the FBI and the Justice Department '... has included flawed forensic testimony from the agency'...''
The inquiry, which covers cases dating prior to the year 2000, was launched after the Post published an expos(C) in 2012 about thousands languishing in prison and on death row due to the FBI's false evidence. Throughout the 1980s and 1990s, FBI hair and fiber experts had claimed matches on hair in 2,600 cases that resulted in convictions and 45 where a death sentence was handed down.
Prior to the late 1990s, when modern methods of DNA analysis were introduced, it was routine for courts to accept claims that a defendant's hair matched those found at a crime scene, based purely on a visual comparison, without any further analysis. These claims were completely bogus, but the FBI laboratory, celebrated by police and the media as the ''gold standard'' for forensic analysis, promoted this anti-scientific nonsense as correct procedure.
The Post notes that in the coming months the FBI will be notifying defendants in 134 non-capital and two death penalty cases of errors made during their trials. Only 10 percent of the total number of convictions in the period 1985-2000 have been reviewed.
The report states that the flawed methods and testimony of federal officials were systemic, and not the result of individual misconduct, as the entire 10-member team responsible for the majority of the FBI's forensic work was implicated in the findings. ''This issue has been raised with the FBI but not resolved to date,'' stated the DOJ's former director of enforcement Maureen Killion in a 2002 email to then-assistant attorney general Michael Chertoff, among others.
The findings of widespread misconduct by the FBI come amid federal officials' numerous attempts to stonewall the release of the information. The report notes that FBI officials first ordered a review of prior forensic evidence in 1997, but ''inattention and foot-dragging by the Justice Department and the FBI led them to ignore warnings'' about incorrect methods which had led to the imprisonment and deaths of untold numbers.
Furthermore, it was reported in 2012 that the Justice Department had long known of the flawed convictions, but had opted not to inform defendants or their lawyers about the suspicions, keeping them unaware they had the grounds for appeal. The inquiry was again held up in August 2013 when initial findings ''troubled'' officials because essentially every case reviewed showed false testimony, in which forensic analysts were found to have ''exceeded the limits of science.''
In regard to the latter instance, James Aren Duckett, an inmate currently on death row for a murder conviction based on hair-related evidence, was denied an appeal by the US Supreme Court in the 11-month period in which the report was delayed, and now faces a limited number of legal options as a result.
''I don't know whether history is repeating itself, but clearly the [latest] report doesn't give anyone a sense of confidence that the work of the examiners whose conduct was first publicly questioned in 1997 was reviewed as diligently and promptly as it needed to be,'' Michael R. Bromwich, the former inspector general for the DOJ and currently a law partner at Goodwin Procter, said of the findings.
FBI officials said that the 11-month delay had arisen ''from a vigorous debate that occurred within the FBI and DOJ about the appropriate scientific standards we should apply when reviewing FBI lab examiner testimony'--many years after the fact.'' Such an explanation defies logic, however, as even thePost notes that since the 1970s hair association was considered to be an invalid form of identification.
The inquiry into flawed forensic methods is the latest in a number of findings of mass injustice perpetrated by federal authorities. Last year, the New York Times published an account of internal investigations by the FBI between 1993 and 2011, finding that the FBI had declared its officers were justified in every one of more than 150 fatal shootings that occurred during that period.
That report had been prompted by criticism of the FBI's fatal shooting of Boston Marathon bombing witness Ibragim Todashev in May of 2013, of which the agent involved was also absolved of guilt by federal officials in March of this year.
This piece was reprinted by RINF Alternative News with permission or license.
It is clear that without an overall military operation to uproot Hamas control of Gaza, no drilling work can take place without the consent of the radical Islamic movement.
"Israel's current offensive in the Gaza Strip is by no means an energy war", writes Allison Good in The National Interest in a response to my Ecologist / Guardian article exposing the role of natural gas in Israel's invasion of Gaza.
This "has not stopped conspiracy theorists from alleging that the IDF's Operation Protective Edge aims to assert control over Palestinians gas and avert an Israeli energy crisis."
Describing me as a "self-proclaimed" international security journalist engaging in "shoddy logic, evidence and language", Good - who works as a contractor for Noble Energy, the Texas-based oil major producing gas from Israel's reserves in the Mediterranean Sea - claims that:
"Israel is nowhere close to experiencing an energy crisis and has no urgent or near-future need for the natural gas located offshore Gaza. While Israel gains nothing for its energy industry by hitting Gaza, it stands to lose significantly more."
If you don't like the evidence - ignore it
Yet Good's missive is full of oversimplifications and distortions. She points out that Israel's recently discovered Tamar and Leviathan fields together hold an estimated 30 trillion cubic feet of gas - which, she claims "are expected to meet Israel's domestic energy needs for at least the next twenty-five years" while simultaneously sustaining major exports.
"Israel is not using Operation Protective Edge to steal the Gaza Marine gas field from the Palestinians, and it is irresponsible to claim otherwise", she asserts. Yet her blanket dismissal simply ignores the evidence.
In early 2011, Prime Minister Benjamin Netanyahu proposed new negotiations with Palestinian Authority President Mahmoud Abbas Abu-Mazen over development of the Gaza Marine reservoir.
"The proposal was made in view of Israel's natural gas shortage following the cessation of gas deliveries from Egypt", reported the Israeli business daily Globes.
US-based Noble's Gaza gas grab
But since 2012, Israel began unilaterally developing the Noa South gas reserve in the Mediterranean off the coast of Gaza, estimated to contain about 1.2 billion cubic metres.
According to Globes, Israel had previously "refrained from ordering development of the Noa field, fearing that this would lead to diplomatic problems vis- -vis the Palestinian Authority" as the field is "partly under the jurisdiction of the Palestinian Authority in the economic zone of the Gaza Strip."
Allison Good's employer, Noble Energy, "convinced" Israel's Ministry of National Infrastructures that the company's drilling would "not spill over into other parts of the reserve."
"Israel wanted to cooperate with the Palestinian Authority to develop Israel's Noa South reservoir, which spreads into Gaza's maritime area", reported Globes. "In the end, Israel decided to develop the Noa reservoir without any official agreement."
Israel's secret gas talks
Despite repeated breakdowns in Israeli-Palestinian negotiations to exploit the Gaza Marine gas reserves, Israel's interest only accelerated.
In May last year, Israeli officials were in "secret talks" for months with the British Gas Group (BG Group), which owns the license over Gaza's offshore resources, over development of the reserves.
According to the US Energy Information Administration (EIA), the Gaza Marine holds about 1.6 trillion cubic feet in recoverable gas, and "offshore Gaza territory may hold additional energy resources."
Determining the size of these additional resources requires further exploration which, however, is limited by "uncertainty around maritime delineation between Israel, Gaza, and Egypt."
Senior Israeli sources said that the Gaza gas issue was expected to come up in US President Barack Obama's talks with Israeli leaders during his visit to Israel at the time.
The Palestinians - who own the gas - were excluded
The talks also included Netanyahu's personal envoy Yitzak Molcho and former British Prime Minister Tony Blair in his capacity as Quartet (US, UK, EU, Russia) special envoy to the Middle East.
Palestinian leaders, though, were excluded from these talks due to "political sensitivities and the complex relationship between the Palestinian Authority and Hamas."
By October that year, the Financial Times reported that Netanyahu remained "very supportive" of the Gaza Marine gas project "which would see the fields exploited on behalf of the Palestinian Authority by investors led by BG Group."
If all went ahead, the fields could be producing gas by 2017, generating "$6bn to $7bn of revenues a year." An "energy industry source" cited by FT told the newspaper that:
"Israel may now see Gaza Marine as providing a useful alternative source of gas, especially at a time when its pipeline imports from Egypt have been disrupted due to unrest in the Sinai peninsula.
"Mr Netanyahu's government faces criticism and a court challenge from opposition politicians over its plans to export up to 40 per cent of natural gas produced from its own, much larger Mediterranean gas reserves.
"Israel, the industry source said, may feel that gas from Gaza would allow it to reduce its reliance on the consortium led by Noble and Delek Energy now developing Israel's Tamar and Leviathan offshore gasfields."
Quashing the gas deal
But as Good herself noted in the same month in Dubai's The National, there remained one problem:
"Hamas retains de facto jurisdiction over the Gaza Strip and, consequently, over Gaza Marine. The PA cannot negotiate on behalf of Hamas, and any agreement that Israel could make with Ramallah would certainly be declared null and void in Gaza. Israel also still refuses to negotiate with Hamas."
And despite negotiations to exploit Gaza's gas speeding ahead between Israeli government and BG Group officials, Netanyahu "quashed" a $4 billion economic stimulus initiative proposed by US Secretary of State John Kerry which "included a proposal for the exploitation of Gaza Marine."
Why was Netanyahu simultaneously pushing forward negotiations over Gaza's gas, while also blocking and excluding any deal that would grant any Palestinian entity inclusion in the deal?
Israel's gas reserves inflated, consumption understated
As noted in my article, and ignored by Noble Energy contractor Allison Good, the drive to access Gaza's gas was likely magnified in the context of a report by Israeli government chief scientists Sinai Netanyahu and Shlomo Wald of the Energy and Water Resources Ministry.
That report was submitted to the Tzemach committee tasked with drafting a national gas policy, but was covered up until Ha'aretz obtained a leaked copy.
The Tzemach committee recommended the government to export 53% of its gas - reduced to 40% this June - amidst widespread allegations of "improper conduct" and deliberate inflation of reserve figures.
Indeed, according to the report of the Israeli chief scientists, the government's gas policy is based on underestimating future Israeli demand and overestimating the country's gas production potential.
In reality, the scientists said, Israel will need "50% more natural gas than has been forecast until now and its offshore reserves will be empty in less than 40 years."
Israel's looming gas crunch
The most optimistic estimate received by the Tzemach committee was that Israel would need 364 billion cubic meters of gas. In contrast, the chief scientists argued that by 2040, Israel would need 650 billion cubic meters, after which the country would consume 40 billion cubic meters of gas per year.
At this rate, "even if Israel chooses not to export any gas, it will entirely exhaust its offshore reserves" by 2055. This assessment, further, ignores that "not all the gas is likely to be commercially extractable."
The upshot is that Israel cannot simultaneously export gas and retain sufficient quantities to meet its domestic needs.
And if Israel exhausts its gas resources "it will be forced to return to oil to meet its energy needs, even though global oil production is expected to start declining by 2035." The scientists noted that "if oil output drops by even 15%, its price is likely to spike by 550%."
These concerns are compounded by the consistent under-performance of several of Israel's recent gas discoveries compared to the hype, such as in the Sara, Myra, Ishai, and Elijah-3 reserves.
As Israel faces a 2015 gas shortage, Gaza's gas is a cheap stop-gap
Sohbet Karbuz, head of hydrocarbons at Observatoire M(C)diterran(C)en de l'Energie (OME) in Paris, points out that much of the gas was not in hindsight commercially recoverable. As he writes in the Journal of Energy Security,
"There is no certainty that it will be commercially possible to produce any percentage of contingent resources."
Israel's gas export policy, he thus remarks with reference to the much-vaunted Tamar and Leviathan fields, is based "partly on a mixture of hype and hope on the one hand, and reserves and prospective resources on the other."
Drilling in Israel's Leviathan reserves which was supposed to begin in December 2013 has been postponed to later this year due to high gas pressures at lower depths. In the meantime, reports Jewish Business News,
"Postponing Leviathan's development could have major repercussions on Israel's economy,which will face a natural gas shortage from 2015."
Israel needs the Gaza Marine as a stop-gap, but wants it cheap, and is unwilling to exploit the reserves through any Palestinian entity.
UK Foreign Office - 'Israel won't pay the full whack'
Official British Foreign Office (FCO) documents obtained under the Freedom of Information Act by the Palestinian think-tank Al-Shabaka based in Washington DC shine new light on this.
According to email correspondence between the FCO's Near East Group and the British Consulate General in Jerusalem in November 2009, Israel had refused to pay market price for Gaza's gas. One Foreign Office official said:
"Israel won't (i) pay the full whack [for the gas] (ii) guarantee to give a certain cut direct to the PA. So BG aren't getting the gas out of the sea-bed. They are content to exploit other reserves and come back to this one when the price is right."
Another email dated 29th June 2010 noted that despite large reserves of gas discovered between Israel and Cyprus giving Israel the opportunity to become a net gas exporter, Israeli officials saw potential for the Gaza Marine to function as "a stop-gap measure before the new finds come fully on stream."
On 8th February 2011, UK ambassador to Israel Matthew Gould wrote to the FCO explaining that Israel intended to therefore seek the development of Gaza's gas reserves as this would
"enhance Palestinian opportunities; reduce Gaza's dependence on Israel; and diversify Israel's sources of gas. [redacted] added that this last point had been given added topicality by the attack this weekend on the gas pipeline from Egypt."
British Gas and Israel collude to exclude Hamas
The biggest obstacle as far as Israel is concerned is Hamas, the Palestinian Authority (PA), and the prospect of a strong independent Palestinian state.
An April 2014 policy paper for the European Parliament's directorate-general of external policies points out that "distrust" between all these parties, particularly "political divisions on the Palestine side" have "hindered the negotiations."
After Hamas was elected to power in the Gaza Strip in 2006, the group declared from the outset that Israel's agreements with the PA were illegitimate, and that Hamas was the rightful owner of the Gaza Marine resources.
But BG Group and Israeli officials had come up with a strategy to bypass Hamas. A BG official told the Jerusalem Post in August 2007 that
"BG and Israel have arrived at an 'understanding' that will transfer funds intended for the PA's Palestinian Investment Fund into an international bank account, where they will be held until the PA can retake control of the Gaza Strip."
Under this plan, "Both Israel and BG intend that until the PA is able to remove Hamas from power in the Gaza Strip, the money will be held in an international bank account. Neither side wants the money to go to fund terror-related activities."
Hamas must be uprooted from Gaza
The plan was, according to an Infrastructures Ministry official cited by the Jerusalem Post, about "circumventing the possibility that Israeli money will end up in the wrong hands" by arranging "a payment plan" that would "completely exclude Hamas".
In the same year, incumbent Israeli defence minister Moshe Ya'alon - then former IDF chief of staff - explicitly advocated that the only way in which Gaza's gas could be developed was through an Israeli military incursion to eliminate Hamas.
Ya'alon's concern was that "Palestinian gas profits would likely end up funding terrorism against Israel", a threat which "is not limited to Hamas" and includes the Fatah-run PA. As preventing gas proceeds from "reaching Palestinian terror groups" is "impossible", Ya'alon concluded:
"It is clear that without an overall military operation to uproot Hamas control of Gaza, no drilling work can take place without the consent of the radical Islamic movement."
Ya'alon's concerns voiced in 2007 - and the prospect of using military force to begin gas production in Gaza - remain relevant today. As the man in charge of Israel's current war on Gaza, Ya'alon is now in a position to execute the vision he had outlined a year before Operation Cast Lead.
Extending Israeli sovereignty over Gaza
Thus, the exclusion of Palestinian representatives - whether Fatah or Hamas - from the latest negotiations between Israel and BG Gas is no accident.
While PA president Mahmoud Abbas was independently seeking to reach a deal with Russia's Gazprom to develop the Gaza Marine, Netanyahu had already "made explicitly clear that he could never, ever, countenance a fully sovereign Palestinian state" - which is why he deliberately torpedoed the peace process, according to US officials.
The other factor in this equation is the legal challenge to the Gaza gas proposals from Yam Thetis, a consortium of three Israeli firms and Samedan Oil.
Samedan is a subsidiary of the same US oil company, Noble Energy, that employs National Interest contributor Allison Good, and which has been operating in the Noa South field that overlaps Gaza.
Yam Thetis' principal argument was that "BG had no right to drill in Palestinian waters as the Palestinian Authority is not a state and cannot grant such a right to drill in offshore Gaza."
The upshot is that Noble Energy's consortium should have the right to extend its drilling into the Gaza Marine on behalf of Israel - and at the expense of the Palestinians.
Removing the obstacles - Hamas and the PA
Since the Oslo Accords, although the PA's maritime jurisdiction extends up to 20 nautical miles from the coast, Israel has incrementally reduced Gaza's maritime jurisdiction by 85% from 20 to 3 nautical miles - effectively reversing Palestinian sovereignty over the Gaza Marine.
But with Israel's determination to access Gaza's gas accelerating in the context of the risk of a 2015 energy crunch, the fundamental obstacle to doing so remained not just the intransigent Hamas, but an insufficiently pliant PA seeking to engage the west's arch-geopolitical rival, Russia.
Israel's own commitment to blocking a two-state solution and bypassing Hamas meant that its only option to bring Gaza's gas into production was to do so directly - with, it seems, the competing collusion of American and British energy companies.
The IDF's Gaza operation, launched fraudulently in the name of self-defence, is certainly though not exclusively about permanently altering the facts on the ground in Gaza to head-off the PA's ambitions for autonomously developing the Marine gas reserves, and to eliminate Hamas' declared sovereignty over them.
Also by Nafeez Ahmed: 'Gaza: Israel's $4 billion gas grab'.
Dr. Nafeez Mosaddeq Ahmed is Executive Director of the Institute for Policy Research & Development in London. He has advised the British Foreign Office, Royal Military Academy Sandhurst, and US State Department, and his work was officially used by the 9/11 Commission. He writes for The Ecologist and The Guardian on the geopolitics of interconnected environmental, energy and economic crises.
His latest nonfiction book is A User's Guide to the Crisis of Civilization: And How to Save it (2010), and his forthcoming novel, Zero Point, is out this August.
31 July 2014Last updated at 11:44 ET By Joe MillerTechnology reporterThe BBC has seen evidence that appears to confirm hackers stole several secret military documents from two government-owned Israeli companies that developed the Iron Dome missile defence system.
The breaches were first publicised by security blogger Brian Krebs on Monday.
The companies denied their classified networks had been infiltrated.
However, the team that discovered the incidents has given the BBC access to an intelligence report, which indicates hundreds of files were indeed copied.
The documents, which were stolen over a period of many months, relate to:
Arrow III missiles unmanned aerial vehicles (UAVs), commonly known as drones ballistic rockets Continue reading the main storyThe data collected makes strong indications that the actors behind this attack originated from China''
End QuoteCyberESI reportCyber Engineering Services (CyberESI) tracked the activities of the hackers over eight months between 2011 and 2012.
It said the data taken by the hackers suggested they had been after intelligence relating to Iron Dome.
Iron Dome is a complex anti-missile defence system, which can intercept and destroy rockets and shells.
The technology has been widely credited with preventing the deaths of many Israeli civilians during the ongoing conflict with militants from Gaza.
CyberESI's report, compiled in 2013, also indicates the attacks were made using highly sophisticated tools resembling those used by Chinese hackers to infiltrate US defence firms - an attack in which the Chinese government denies any involvement.
"The data collected makes strong indications that the actors behind this attack originated from China," it says.
"This assertion is based on the activity during the past year that Cyber Engineering Services has observed on compromised networks, as well as the geo-location of the IP [internet protocol] addresses retrieving the exfiltrated data."
"The nature of exfiltrated data and the industry that these companies are involved in suggests that the Chinese hackers were after information related to Israel's all-weather air defence system called Iron Dome."
Gigabytes stolenCyberESI, which operates out of Maryland in the US, monitored data being stolen from two leading Israeli defence contractors:
Israel Aerospace Industries (IAI), a government-owned company that develops missiles and aircraft Rafael Advanced Defense Systems, a government-owned company established in 1948, which develops surface-to-air missiles A spokeswoman for IAI initially confirmed to Mr Krebs the attack had taken place and been "reported to the appropriate authorities".
However IAI subsequently said the "information reported regarding the leakage of sensitive information is incorrect" and only its "civilian non-classified" network had been hacked.
A spokesman for Rafael said the company did "not recall such an incident".
But the report seen by the BBC suggests sensitive data was taken from IAI and that Rafael's network was compromised, with hackers able to deactivate security software and harvest authentication data, including passwords.
In total, the report says, gigabytes of data were stolen from the Israeli companies, including:
word documents power point presentations spreadsheets PDFs executable (.exe) files Some of the stolen technical documents are said by CyberESI to have contained intellectual property data and were marked as being controlled by US government International Traffic in Arms (ITAR) regulations.
US connectionsBoth IAI and Rafael were heavily involved in developing the Iron Dome missile defence system, which allows Israel to intercept rockets fired by Hamas from the Gaza Strip.
The US, which already collaborates with Israeli firms over Arrow III - jointly designed by IAI and Boeing, now wants to invest in future versions of Iron Dome technologies.
In May 2013, the Pentagon accused China of carrying out a sophisticated cyber-spying campaign on US diplomatic, economic and defence organisations.
The raid on the Israeli companies bore similar characteristics, experts at CyberESI told the BBC, using tools that were "known to originate from" China.
The attacks were part of an advanced persistent threat (APT) - a form of highly organised and targeted hacking.
APTs have been used for industrial espionage in the past and tend to use sophisticated methods not easily available to the vast majority of cyber-thieves.
Executive emails stolenCyberESI's report also featured a third Israeli company, Elisra, originally a US company and now a leading supplier to the Israel Defense Forces (IDF).
Elisra, which is not involved in Iron Dome, appears to have been comprehensively infiltrated by the hackers, who stole data from folders named "Military Spacs" and "UAV" and infiltrated the email accounts belonging to the chief executive and several senior managers.
The attackers also stole passwords and sign-in details, allowing them to roam around the networks undetected.
Elisra did not respond to a BBC request for comment.
In January 2014, another security company reported that 15 Israeli defence computers had been compromised via a malicious email attachment.
Militant Islamist fighters take part in a military parade along the streets of northern Raqqa province(Reuters)
The Islamic State of Iraq and the Levant (Isis) has told the Palestinian people that it is "only a matter of time" before they reach Palestine to join the fight against "barbaric Jews".
The Islamic militant group, who last month announced a "Caliphate" straddling the Iraqi-Syrian border and renamed themselves the Islamic State, released the provocative statement on an Isis-affiliated Twitter account.
"It is only matter of time and patience before it [Islamic State] reaches Palestine to fight the barbaric Jews and kill those of them hiding behind the gharqad trees - the trees of the Jews," the statement read.
The group said it would do "everything within its means" to continue the fight against any obstacle on the way to "Palestine", alluding to the Middle Eastern territory before the creation of the State of Israel in 1948.
"As for the massacres taking place in Gaza against the Muslim men, women and children, then the Islamic State will do everything within its means to continue striking down every apostate who stands as an obstacle on its paths towards Palestine," the group said.
The group and its "Caliph", Abu Bakr al-Baghdadi, have faced criticism from some quarters for not coming to the aid of Palestinian civilians being killed in the Israeli Defense Forces' Operation Protective Edge in Gaza.
The comments issued was not to be taken lightly as the group do not offer "empty" words like other Arab nations who speak and do not act, the statement said.
"It is not the manner of the Islamic State to throw empty, dry and hypocritical words of condemnation and condolences like the Arab tawaghit do in the UN and Arab League."
The group stormed across Iraq, capturing key Sunni cities such as Mosul and forcing more than a million people to flee their homes, according to the United Nations.
The UN claims 225,178 Palestinians are now taking refuge in 86 shelters while the Gaza health ministry said 1,364 Palestinians have been killed, 315 of those children.
The Israeli military has confirmed the deaths of 56 soldiers while two Israeli civilians and one Thai national have also been killed in the conflict.
Dutch police to get tough on anti-semitism at pro-Gaza ralliesFriday 01 August 2014
Public prosecutors in Amsterdam and The Hague are to be extra alert for anti-semitic statements at pro-Gaza and other demonstrations in the coming days.
The decision follows criticism of the lack of police action at a rally in The Hague during which some demonstrators were chanting 'death to Jews'. Two people have since been arrested.
There has been a rise in anti-semitic incidents in the Netherlands since fighting flared up again in Gaza, and Jewish groups have complained that officials are not taking them seriously enough.
However, justice ministry officials will now monitor demonstrations and use interpreters on the ground to monitor speeches and chants. Jihadist flags and face-coverings will also be banned under certain circumstances.
Violence
On Friday, a demonstration against police violence will be held in The Hague and there have been reports supporters of the Muslim extremist group IS (formerly Isis) may be present.
On Sunday, some 5,000 protestors are expected at a pro-Gaza rally in Amsterdam.
'Nazi symbols, Hitler salutes and burning flags will not be tolerated,' an Amsterdam police spokesman told website nu.nl. 'The same applies to the ISIS flag. Demonstrators may not carry it.'
Attack
Meanwhile, police in Amsterdam say they are investigating an attack on a Jewish woman living in the east of the city who hung an Israeli flag from her balcony.
Seraphina Verhofstadt-Makker says she was hit in the face and stomach by three men wearing Palestinian scarfs on Tuesday.
Police are looking for witnesses to the attack and say the men may have traces of red spray paint on their clothing. Verhofstadt-Makker used the paint to protect herself.
Disgusting
MPs from across the political spectrum condemned the incident. Labour MP Ahmed Marcouch (PvdA) said it was 'disgusting'.
Elbert Dijkgraaf of the fundamentalist Christian group SGP said: 'It is unbelievable how much hatred of Jews is coming to the fore these days. Sad, shocking and all the more reason to come down hard on anti-semitism.'
Earlier another building carrying the Israeli flag had what news agency ANP described as a 'fire bomb' thrown at it and the owners were sent a threatening letter.
In The Hague, a driving school owner is being sought by police after placing a film on Facebook in which he describes Zionists as zombies. In the film, the man says 'these zombies should be shot dead' and shoots in the air several times with a pistol.
Facebook has since removed the video as hate speech.
(C) DutchNews.nl
Please enable JavaScript to view the comments powered by Disqus.
German protesters march from Griesheim to the Dagger Complex, a US intelligence base. Photograph: Philip Oltermann for the Guardian
One morning last July, the German intelligence service knocked on Daniel Bangert's door. They had been informed by the US military police that Bangert was planning to stage a protest outside the Dagger Complex, an American intelligence base outside Griesheim in the Hesse region. Why hadn't he registered the protest, and what were his political affiliations? they asked.
Bangert explained that he wasn't planning a protest and that he didn't have any links to political groups. All he had done was put a message on Facebook inviting friends to go on a "nature walk" to "explore the endangered habitat of NSA spies". Eventually, the agents left in frustration.
Twelve months later, Bangert's nature trail has not only become a weekly ritual in Griesheim, but also the frontrunner of a new multi-generational German protest movement against digital surveillance.
On Saturday, around 130 "spy spotters" from across the country joined Bangert and his "Society for the Protection of NSA Spies" for the first anniversary of his ramble from Griesheim's town square to the Dagger Complex.
The 29-year-old heating engineer, who is currently retraining as an IT worker, first became interested in the US intelligence service after the publication of Edward Snowden's revelations in June 2013. When the NSA advertised a job for a security expert in the area, it seemed to confirm his suspicions about the fenced-off site in his home town.
"There had always been rumours that the Dagger Complex was full of US spies when I grew up", he said. "The incredible thing is that those rumours have now turned out to be true."
According to reports in the German media, the Dagger Complex is the central base for US surveillance operations in Europe, containing the NSA's military branch as well as the "European Cryptologic Centre" in which several hundred NSA employees collect and analyse data with the help of tools such as the notorious Xkeyscore programme.
Usually, Bangert's spotters carry at least a pair of binoculars and a couple of surveillance cameras made of cardboard. Registration numbers of cars parked at the facility are logged, but actual sightings of NSA employees are rare: "Spies are shy creatures," Bangert said.
On Snowden's birthday, the walkers brought along cake in order to "lure the spies out of their hiding holes". When the owners of the Dagger Complex complained to police about the rubbish left behind by the protesters, they brought rakes and brushes and offered to clean up inside the complex.
For the anniversary, the organisers built a "bed for Snowden", as a symbolic reminder of their ongoing campaign for Germany to offer asylum to the US whistleblower.
So far, Bangert's only interaction with those working in the Dagger Complex is the time a departing employee wound down his car window and called him a "dumbass motherfucker".
"My aim is to get on the NSA's nerves whenever I can," Bangert told the Guardian. "And I think they are pretty irritated at the moment."
The protesters include students in their late teens as well as pensioners. Nadine, a 20-year-old from Lower Saxony, has been joining the protest once a month since last autumn. "Most people prefer to complain from the comfort of their sofa," she said, "but here people are actually doing something to voice their complaints."
Frieder Haug, a 67-year-old retired priest who is also a member of the activist network Attac, said he joined the walks because he felt the protests against digital surveillance had managed to bring together different people in the way the peace movement had in the 1980s.
"Originally, I didn't want to join Attac because it was only full of people my age. Now there is finally a new generation of young people who are not only politicised, but also stubborn in getting their point across."
Bangert said he planned to continue the nature walks indefinitely. "Over the last 12 months, in spite of all the politicians expressing their outrage, absolutely nothing has changed. So of course we have to keep on going".
Germany is the world's leader in penis enlargements, with five times as many people in the country undergoing the procedure than anywhere else in the world. Globally, Germany carries out the fourth highest amount of cosmetic surgery operations.
Figures released by the International Society of Aesthetic Plastic Surgery, showed Germany performed 2,786 of the 15,000 penis enlargements across the globe in 2013. The second highest country, Venezuela, performed 473 while Iran, at the bottom of the chart, had 12.
The German Centre for Urology and Phalloplasty Surgery says it has performed more than 6,000 enlargements. They claim they can extend the organ anywhere from three to six centimetres. A spokesman for the Centre told The Local on Thursday he didn't know why German was rising up to the top table.
The trend has been growing for some time. In 2011, surgeons in Germany reported a swell in demand for the operation.
''Penis enlargements are now in seventh place among aesthetic surgery procedures for men,'' said Sven von Saldern, the president of the German Association of Aesthetic Plastic Surgery in 2011. ''That surprised even us.''
However, penis enlargements are by no means the most popular form of plastic surgery in Germany.
Germany ranks fourth behind Brazil, the US and Mexico for the total number of cosmetic procedures performed last year. The number stands at 654,115.
SEE ALSO: More German men getting plastic surgery
For more stories about Germany, join us on Facebook and Twitter
Huge Bavarian crop circle puzzles crowdsA mysterious crop circle in Bavaria has attracted thousands of visitors since it was spotted in a wheat field last ...
Germany evacuates embassy in LibyaUPDATE: Germany pulled its embassy staff out of Tripoli on Monday, a day after advising all its citizens currently in ...
Germany's biggest tabloid attacks IslamGermany's biggest newspaper, Bild, was forced to climb down over the weekend after a highly critical and controversial comment piece ...
Job seekers frustrated with application waitA new YouGov survey shows job seekers in Germany are exasperated with the application process, complaining about poor job adverts ...
Your lottery numbers are 9, 10, 11, 12 and 13Three lucky Germans will take home a six-figure prize after an extremely rare lottery draw. The lucky numbers on Wednesday ...
Hamburg could treat infected Ebola doctorUPDATE: A doctor infected with the deadly Ebola virus while trying to help stop it spreading through West Africa could ...
Foreigners less likely to get jobs than GermansForeigners from outside the EU suffer from a much lower employment rate in Germany than native citizens and EU immigrants ...
Visa chaos hits Bayern Munich's USA tourBayern Munich boss Karl-Heinz Rummenigge is among the club's staff and players who could not join a week-long tour to ...
Should Germany legalize cannabis?A New York Times editorial on Sunday called for the US to drop its ban on marijuana, calling the strongly-worded ...
Germany denies 'land for gas' deal with PutinUPDATE: Chancellor Angela Merkel and Russian President Vladimir Putin have been working on a secret peace plan for Ukraine, The ...
Today's headlines
A Deutsche Bahn train. File photo: DPA
Thirty-five people were injured, four of them seriously, when a passenger train collided with a freight train late Friday near Mannheim station in southern Germany, the operator Deutsche Bahn said. READ
Hamburg's UKE isolation ward is ready to take patients. Photo: DPA
Germany's high-tech isolation wards remained on alert on Friday, ready to receive Ebola patients should they be required to. German airports seemed less prepared for the potential dangers of the viral epidemic, however. READ
The fire caused by the crash. Photo: DPA
UPDATE: Two men died on Friday afternoon when a plane crashed in Bremen, causing a fire and a series of explosions in a warehouse near the city's airport. READ
Merkel in M¼nster last year at a meeting of her party's workers' wing. Photo: DPA
Chancellor Angela Merkel faced a rebellion from within her own party on Friday after an unlikely coalition formed in favour of tax cuts for workers on lower incomes. READ
Expat Dispatches
Kleing¤rten in Leipzig. Photo: DPA
Visitors to Germany can sometimes be confused by the country's love of allotments in cities, known as a Kleingarten. Teacher and blogger Kathleen Ralf tells us what it's all about. READ
Closed until further notice: Berlin's troubled new airport. Photo: DPA
Too few lightning rods and an undersized emergency generator have prevented part of Berlin's new airport from opening. Safety inspectors refused to sign off on the airport's north pier, thwarting progress on the massively delayed construction project. READ
Photo: DPA
Two thirds of Berlin's 12,000 tourist apartments advertised on sites such as Airbnb were being run illegally from Friday following a law change, leaving hosts open to potential punishment. READ
Fritzi underneath the train. Photo: Freiwillige Feuerwehr Unterschlieheim/DPA
A lost pet goat called Fritzi halted trains to Munich Airport and had to be rescued from the tracks after suffering a concussion. READ
Photo: EPA/Tibor Illyes HUNGARY OUT
Germany's U19 football team added to a glorious summer of sport for the country by winning the European Championships in Budapest on Thursday night. READ
World War I anniversary
August 1914. German soldiers march off to war in France. Photo: DPA
A hundred years ago on Friday Germany declared war on Russia and was preparing for an attack on France in the hope that Britain would stay neutral. Four years on, famine was ravaging the country and two million soldiers had been killed on the battlefield. READ
RECEIVE OUR NEWSLETTER AND ALERTS
Society
Meet the man allowed to grow his own cannabis
Society
Your lottery numbers are 9, 10, 11, 12 and 13...
Gallery
Five reasons to visit Oktoberfest (and five not to)
Society
Huge Bavarian crop circle puzzles crowds
Analysis & Opinion
Have Your Say: Should Germany legalize cannabis?
Gallery
Hamburg harbour lit up in blue
Business & Money
JobTalk: 'Application process is failing'
Society
This man wants to give all of us '¬12,000 a year
Education
Top university switches master's courses to English
Travel
Plans unveiled for bike trail along former Iron Curtain
Gallery
A German soldier's life behind WWI lines
Education
Raising the bar for law & business in Germany
Business & Money
JobTalk: All you need to know about working in Germany
Features
The Local List Archive - Your guide to all things German
National
Share news tips with The Local Germany
Sponsored Article
Bilingual school turning education on its head
Sponsored Article
CurrencyFair: Why it pays when making overseas transfers
A sticker demanding asylum for US National Security Agency whistleblower Edward Snowden is seen outside the partially-finished new headquarters of Germany's Federal Intelligence Service. Photograph: Adam Berry/Getty Images
Opposition parties in Berlin have threatened to ask the constitutional court to overturn the German government's refusal to grant Edward Snowden asylum to testify before a Bundestag inquiry.
A year after the NSA whistleblower sought asylum in Russia, German MPs are examining his revelations of mass US surveillance of international communications in Germany '' including Chancellor Angela Merkel's mobile phone.
But members of the inquiry are divided along party lines over whether to hear testimony from the man whose revelations brought the committee into existence.
Mr Snowden has refused a proposal for an informal meeting in Moscow, saying he is only interested in testifying formally, in person and in Berlin. But Germany's coalition partners of Christian Democrats (CDU) and Social Democrats (SPD) voted in June to refuse this because it would require a successful asylum application.
Green and Left Party MPs are insisting Mr Snowden be given asylum because they say he cannot testify freely while in Russia. If the government parties don't change their position at the next inquiry meeting, Green Party committee member Konstantin von Notz will ask the constitutional court to force them.
''The law says the government is obliged to provide administrative assistance for parliamentary inquiries,'' he said yesterday. ''It is a disgrace for western democracies that Edward Snowden still has to hide himself in authoritarian Russia at Vladimir Putin's discretion.''
Strained relationshipBehind the scenes, government officials say they are not willing to grant Snowden asylum for fear of damaging German security interests and adding further strain to the transatlantic relationship.But even CDU committee chairman Patrick Sensburg concedes that Mr Snowden is an important witness for the inquiry. ''He has internal knowledge of the NSA and can report on what files he secured and what they say,'' said Mr Sensburg.
The federal government had, he said, weighed up the pros and cons of the matter '' the need to clarify NSA surveillance versus the potential diplomatic fallout, and signalled it was unwilling to grant asylum. As a wanted man, he said officials indicated Germany would be obliged to pass Mr Snowden on to the US authorities under extradition agreements.
''In weighing things up the government has turned down [the request] saying we cannot make exceptions and give him a right of residency,'' said Mr Sensburg.
''Personally I feel sorry for a 31 year-old stuck in Russia unable to travel freely . . . Snowden did this not to damage the US but to do something for his homeland, as a patriot.''
Yesterday Mr Snowden's lawyer Svetlana Gannuschkina said she assumed his one-year asylum period in Russia, which runs out today, would be renewed.
Speaking on 12 May, David Lidington, Minister for Europe said:
Today marks 20 years since the Nagorno-Karabakh ceasefire agreement. While it brought an end to the fiercest fighting, real peace is yet to be achieved. Sniper fire continues to take lives on both sides; often the soldiers fighting are younger than the ceasefire itself. A humanitarian crisis continues as hundreds of thousands of displaced people still lack an adequate resolution to their plight. Peace will only be possible through compromises on both sides.
A generation now exists who only know of conflict between Armenians and Azerbaijanis, yet these two peoples have a long, shared history of living together peacefully. Peace will only be possible once both sides have created a situation where an agreement is acceptable to their populations. Unfortunately this is not the case today. The UK remains committed to bringing people together, and developing greater understanding between the communities in Armenia, Azerbaijan and Nagorno-Karabakh. People to people interactions, and the peace-builders who sustain these links, are an essential element of any peace and reconciliation process.
The UK supports the work of the Minsk Group Co-Chairs who continue to work hard to facilitate progress on the peace agreement. The elements making up a deal, including the return of occupied territories and the acceptance of a free expression of will on the status of Nagorno-Karabakh, were once again set out clearly on 7 May by the US Co-Chair, Ambassador James Warlick. I hope both leaderships show the political courage to bring about this solution for the people of Armenia, Azerbaijan and Nagorno-Karabakh.
Further informationFollow Foreign Office Minister David Lidington on twitter @DLidington
Follow the Foreign Office on twitter @foreignoffice
Follow the Foreign Office on facebook and Google+
The Nagorno-Karabakh Republic Is Another Unknown Country with an Uncertain Future | VICE United States
Since crisis broke out in Kiev, commentators have stayed busy discussing Ukraine's possible ripple effects on several ''frozen conflicts'' in areas around Russia. South Ossetia and Abkhazia in Georgia, and Transnistria in Moldova'--all of which have been involved in conflicts at some point throughout the past couple of decades'--have had their fair share of attention, so why is nobody talking about Nagorno-Karabakh (besides the fact that it's difficult to say)?
Today marks 20 years since war ended in Nagorno-Karabakh (NK), an ethnic Armenian enclave in Azerbaijan that claims independence but, internationally, isn't recognized as independent. From 1988 to 1994, Armenia and Azerbaijan fought over the terrain in a war that killed up to 30,000 people. A Russian-brokered ceasefire was signed in 1994, but soldiers remain armed along the ''line of contact'' and people keep dying; dozens are killed each year, and hundreds of thousands are still displaced. Svante E. Cornell, director of the US-based Central Asia-Caucasus Institute, calls it ''The mother of all unresolved conflicts.''
Recently, tension has escalated. In April, Azerbaijan began large-scale military drills near its border with Armenia. There's also the threat that Russia's annexation of Crimea'--hailed in Armenia, which supports an independent NK, and castigated in Azerbaijan, which does not'--might tip the balance and, in doing so, kick off a regional war that would draw in big players like Russia, Turkey, Israel, and Iran. ''In general, I would be worried about what this means for the South Caucasus,'' said Katherine Leach, British Ambassador to Armenia.
Either way, Russia, which helpfully supplies cash and weapons to both sides of the dispute, looks set to gain from the situation, if only by capitalizing on regional insecurity. Late last year, Russian President Vladimir Putin gave a speech in the Armenian capital of Yerevan, in which he declared: ''Russia will never leave this region. On the contrary, we will make our place here even stronger.''
The disputed territory of Nagorno-Karabakh
In January, the United States Senate Select Committee on Intelligence released its ''Worldwide Threat Assessment," which noted that ''Nagorno-Karabakh and adjacent territories will remain a potential flashpoint'' and that ''prospects for peaceful resolution" were dim. This followed the International Crisis Group's September assessment, which described an accelerating ''arms race'' in Azerbaijan and a ramping up of ''strident rhetoric'' in both countries, with the use of ''terms like 'Blitzkrieg,' 'preemptive strike,' and 'total war,'''
On May 7, James Warlick, co-chair of the Organization for Security and Co-operation in Europe's (OSCE) regional negotiating team, gave a much-anticipated speech on ''The Keys to a Settlement'' in NK. But the speech'--which made elusive calls for ''bold steps,'' ''core principles,'' ''expression[s] of will,'' and ''participation of the people'''--didn't really bring anything new to the diplomatic table. Just a few weeks earlier, Warlick had taken to Twitter to muse: ''What a wonderful Easter! My prayer is for a lasting settlement on #Nagorno-Karabakh.''
But will bloodshed in Ukraine inspire more than just tweets for divine intervention?
Today, Nagorno-Karabakh is a wreck. Ceasefire violations are common, as are muscle-flexing military drills. Soldiers are regularly shot and killed, fueling speculation that the ''frozen conflict'' is about to ''boil.'' Civilians die, too, sometimes by stepping on one of the many, many old landmines that remain scattered around the region. A kind of legal no man's land, NK is a hot-spot for drug smuggling, petty crime, and human trafficking. As you've probably guessed, living conditions suck'--hundreds of thousands of Azerbaijanis are still displaced, with many living in squalid conditions.
And then Ukraine happened. At first, the illegal referendum in Crimea inspired a new push for a resolution in NK; in November, the presidents of Azerbaijan and Armenia met for the first time in three years'--talks that US Secretary of State John Kerry promised ''to be engaged in.'' But, by January, optimism had faded. The beginning of the year saw a rise in ceasefire breaches, reports of civilian casualties, deaths at the ''line of contact,'' and the arrest, in Azerbaijan, of an alleged Armenian infiltrator.
When residents of Crimea voted to separate from Ukraine and join Russia, the UN passed a resolution condemning the move. Azerbaijan backed it, but Armenia did not. In the so-called Nagorno-Karabakh Republic, authorities reportedly hosted a public celebration in honor of the now-purportedly-free Crimeans.
The flag of the Nagorno-Karabakh Republic
It's not like we didn't see this coming. Things have been deteriorating for some time, but recent years have seen a huge hike in regional military spending. Azerbaijan, in particular, has been acquiring military assets at a staggering rate, and some fear that the newly-endowed Baku might now feel inspired to test out its arsenals, two decades after its conflict with Armenia.
This is where Russia comes in. It's no secret that Moscow is playing both sides, officially backing Armenia and stationing troops at its base in the country's Gyumri district. In 2012, the Kremlin sent troops from Russia and four other post-Soviet republics to Armenia for the largest military drill to ever take place there. Still, Moscow sells masses of weapons, equipment, and artillery systems to Azerbaijan.
''With Putin back in the Kremlin, I think the main instinct is to preserve the status quo,'' says Thomas de Waal, senior associate at the Carnegie Endowment and author of Black Garden: Armenia and Azerbaijan Through Peace and War. ''[Russians] don't want to do war, which would oblige them to bring in the army on the side of Armenia, but I don't see any evidence that they want peace either'... At the moment, Russia is not in the mood for that kind of creativity. It chooses to lock things down and [maintain] its leverage.''
Each side is vying for Putin's backing, and it's working'--especially in Armenia. Near the end of the NK war, Turkey closed their border to Armenia, leaving the country isolated, and in swooped Russia to help. So it's no surprise that, last year, Armenia (just like Ukraine) announced that it would join Russia's new customs union rather than pursue an EU association agreement.
Should it break out, war in Nagorno-Karabakh could expand quickly. Turkey backs Azerbaijan, as does Israel'--and the latter has sold tons of weapons and a fleet of drones to Baku, reportedly as a means of keeping neighboring Iran (which supports Armenia) in check. A US diplomatic cable from 2009, released by WikiLeaks, quotes Azerbaijani President Ilham Aliyev describing his relationship with Israel ''as being like an iceberg, nine-tenths of it is below the surface.'' Tangled threads of regional alliance come together in NK.
One possibility is that regional diplomatic channels will fall apart. Ongoing OSCE negotiations are being carried out by the so-called ''Minsk Group,'' chaired by the US, France, and Russia. But some doubt that the group can survive, reliant as it is on US-Russia cooperation. If it did crumble, that would be cause for great concern, says Ambassador Leach, since there is no other ''viable alternative'' negotiating format.
Russia's President Dmitry Medvedev (center), Azerbaijan's President Ilham Aliev (left) and their Armenian counterpart Serge Sarkisian (right) speak during their meeting in Krasnaya Polyana near Sochi, Russia on the 23rd of January, 2012. They discussed the Nagorno-Karabakh conflict.
Of course, the switch could always be flicked from inside NK. Azerbaijan and Armenia both have sizeable armies, and the so-called Nagorno-Karabakh Republic has its own defense force. Since the Crimea annexation, Republic authorities have been especially keen to make their voice heard and not just let Armenia do the talking. Early this month, the Republic's representative to the US, Robert Avetisyan, told me, ''It is our deep understanding that the NK Republic should be regarded as the principle party of negotiations with Azerbaijan.''
Some believe that the only conceivable solution is an official, internationally-sanctioned referendum on sovereignty in NK. But exactly who would vote in that referendum remains disputed; would the Azerbaijanis who were booted out of the territory get to cast their votes?
Paradoxically, as a result of the situation in Crimea, Azerbaijan must be cautious. Crisis in Ukraine has highlighted Europe's energy reliance on Russia and accelerated the hunt for non-Russian alternatives. Azerbaijan might be just what the doctor ordered. ''The Caspian region, of which Azerbaijan is the linchpin, is the only major alternative to Russia for energy,'' George Friedman, head of the policy-risk consultancy Stratfor, recently argued. Already, Europe is working to expand gas pipelines from Azerbaijan through the continent. In December, Baku signed a $45 billion natural gas contract with a BP-led group, making Britain the largest foreign investor in the country.
This budding oil and gas relationship might explain why some European states have looked the other way in the face of recent human rights abuses in Baku'--some of them related to NK. Recently, a journalist and a prominent human rights activist were arrested on allegations that they are Armenian spies. ''In Azerbaijan, one of the results of the conflict in Nagorno-Karabakh is a mania about Armenian spies,'' explains Rachel Denber, a regional expert at Human Rights Watch. There have been incidents when the government ''has mobilized Azerbaijani nationalism against any remnant of empathy towards Armenians.''
Of course, it's most likely that neither side wants war. But as we learned in 2008, when Georgia and Russia battled it out over the disputed regions of South Ossetia and Abkhazia, unpredictable things can happen when simmering ethnic tension, revanchist land claims, Russian interest, and lots of guns collide.
For now, Ambassador Leach hopes that ''in the context of Ukraine and this question of the Soviet Union's former internal borders'... more people will make themselves familiar with the situation'' in the oft-forgotten Nagorno-Karabakh.
@katieengelhart
ITAR-TASS: World - US backs France-initiated summit on Nagorno Karabakh '-- spokesperson
WASHINGTON, July 03. /ITAR-TASS/. The United States supports France's initiative to organize in Paris a meeting of the Armenian and Azerbaijani presidents over the Nagorno Karabakh settlement, US Department of State Spokesperson Jen Psaki said on Wednesday commenting on reports about an escalation of tension on the border between the two countries.
In reply to the query about whether she had seen reports that civilian settlements had been bombarded by Azerbaijan in Armenia, she said, ''I don't have any confirmation of those specific reports, but clearly, a peaceful settlement is in the interests of both countries''.
She said that as a co-chair of the OSCE Minsk Group on the settlement in the mostly Armenian populated Azerbaijani enclave, the United States was ''committed to helping both sides reach a peaceful settlement to the Nagorno Karabakh conflict''.
''It's our hope that the presidents of Armenia and Azerbaijan will accept French President Hollande's invitation to hold a summit in Paris as soon as possible, and that they will agree to structured negotiations that will lead to a peace agreement,'' Psaki said. She also noted that the United States called on both sides ''to redouble their efforts at the negotiation table'' and to avoid rhetoric and statements that could further exacerbate the situation.
A third participant in the OSCE Minsk Group, Russia, also supports the idea to organize a new meeting between the Armenian and Azerbaijani presidents. ''As a co-chair, Russia will seek to see a dialogue between the presidents of Azerbaijan and Armenia continued,'' Russian Foreign Minister Sergei Lavrov said after talks with his Armenian counterpart Edvard Nalbandyan on June 23.
Last week, OSCE Chairperson-in-Office Didier Burkhalter also supported the summit.
Yerevan has supported the French initiative put forward in mid-Jay, when the French president visited Azerbaijan and Armenia. Baku said it expected from Paris details of the plan of a new meeting between the two countries' presidents. Last time Aliyev and Sargsyan met in Vienna in November 2013.
Armenia backs Crimea's right to self-determination '-- RT News
Published time: March 21, 2014 23:42Armenian President Serzh Sargsyan (RIA Novosti/Tigran Mekhrabyan)
Armenia has backed Crimea's choice of joining Russia, supporting the right to self-determination for the peninsula's population. In response, Ukraine has recalled its ambassador to Armenia.
"Armenia's principled position on the right to self-determination remains unchanged and has been repeatedly expressed over the years," Armenia's deputy foreign minister, Shavarsh Kocharyan, told Ukrainian Ambassador Ivan Kukhta, as quoted by the Armenian Foreign Ministry's press service.
The meeting, which took place in Armenia's capital of Yerevan, was initiated by the Ukrainian side after Armenia's President Serzh Sargsyan expressed support for the Crimean referendum, stating it was justified.
Sargsyan told his Russian counterpart Vladimir Putin in a phone conversation that the Crimean referendum was a ''model for the realization of self-determination.''
In response, Ukraine recalled its ambassador to Yerevan for consultation on Friday.
Kiev also summoned Armenia's ambassador to Ukraine, Andranik Manukyan, to express its concerns over Armenia's position on the referendum.
On Sunday, over 96 percent of voters taking part in the Crimean referendum answered ''yes'' to the autonomous republic joining Russia. The Crimean parliament also unanimously voted to integrate the region into Russia.
On Friday, Russia finalized the legal process of taking Crimea under its sovereignty, as President Putin signed a law amending the Russian constitution to reflect the transition.
Earlier, Russian lawmakers ratified both the amendment and an international treaty with Crimea and the city of Sevastopol, which was legally required for the incorporation.
The move has been met with an onslaught of international sanctions against Russia for its role in the Ukraine crisis.
Armenia has a strong stance of supporting self-determination.
During the confrontation over Nagorno-Karabakh, which broke out in 1988, the region '' mostly populated by Armenians '' sought independence from Azerbaijan and announced its intention to join Armenia. In 1991, the Nagorno-Karabakh Republic was founded. Azerbaijan tried to regain control over the territory, and the conflict escalated into a full-scale war which claimed the lives of around 30,000 people. The conflict ended in 1994, with Nagorno-Karabakh's independence remaining unrecognized and the region remaining a part of Azerbaijan, according to Baku's legislation. Yerevan has been supporting the Nagorno-Karabakh region, representing its interests in an official capacity.
Since 1994, talks to determine the status of the disputed region have been conducted within the framework of the Minsk Group of the Organization for Security and Co-operation in Europe (OSCE). The group proposed the basic principles for a settlement of the conflict '' known as the Madrid document '' in 2007.
Russia voices concern over violence in Nagorno-Karabakh | Reuters
MOSCOW Aug 2 (Reuters) - Russia expressed concern on Saturday over a flare-up of violence in Nagorno-Karabakh, a breakaway enclave of Azerbaijan with a majority Armenian population, and said any escalation would be unacceptable.
At least 10 people were killed in skirmishes this week between Azeri government forces and ethnic Armenians controlling Nagorno-Karabakh, officials from the two sides said on Friday.
"We see the events of recent days as a serious violation of agreements on a ceasefire and declared intentions to achieve a regulation (of the conflict) through political means," the Russian Foreign Ministry said in a statement.
"We take the position that any further escalation is unacceptable," it said.
Fighting between ethnic Azeris and Armenians erupted in 1991 and a ceasefire was called in 1994. But Azerbaijan and Armenia have regularly traded accusations of further violence around Nagorno-Karabakh and along the Azeri-Armenian border.
Farm workers harvest olives in Puglia. Photograph: Alamy
On one side are Tony Blair, a powerful consortium of energy interests, including BP, and the autocratic ruler of a former Soviet bloc country. On the other are the olive growers of Puglia and a comedian turned political maverick.
News that Britain's former prime minister is to advise the consortium behind the Trans Adriatic Pipeline (TAP), the final leg of a 2,000-mile gas pipeline that will run from Azerbaijan across much of central eastern Europe, has sparked uproar among people living close to its ultimate destination in the heel of southern Italy.
Anger towards the pipeline '' the pet project of Azerbaijan's controversial president, Ilham Aliyev '' has been building up in Puglia for several years, with thousands attending public meetings and demonstrations opposing the project, which is due to start in 2016. Plans for the pipeline to come onshore in Brindisi were ditched following local opposition. The new route will strike land in the less populated municipality of Melendugno.
However, environmentalists claim that Puglia, which boasts two Unesco world heritage sites, will still suffer as a result of the pipeline's rollout. There are fears '' which are rejected by the consortium '' that the pipeline will contaminate fresh water supplies.
Other critics warn that the beach where the pipeline is due to come ashore will be turned into a building site, while the habitat of the local Mediterranean monk seals '' one of the most endangered mammals in the world '' will be threatened.
But TAP says it will not work on the beach in the summer months and that construction work will cease during the seals' mating season. It has also pledged to replant the olive groves belonging to some 150 families in the region. But because some of the trees are up to 2,000 years old, the olive-growers fear the groves will not survive replanting.
"The plan to build such a pipeline in one of the most pristine areas of the Mediterranean is absurd," said Elena Gerebizza from Re:common '' an Italian organisation opposing the pipeline. "Tony Blair is standing against communities that want to protect their land, sea, natural resources, and leave a future to their children."
"This idea is crazy, it makes no sense," said Maria Mancini, a resident of Melendugno. "It is going to ruin the landscape. The people who live here don't want this. We will get dumped with it because we are not rich enough to get listened to when we say no."
Blair, who is keen on holidaying in Italy, may have to think twice before visiting parts of Puglia, it appears. "I was there in January and people are very angry," said Emma Hughes, energy policy officer with the campaign group Platform. "Some people told me they would drive stakes into the rocks and chain themselves there if the company tries to build the pipeline."
The decision to bring in Blair as an adviser on the "reputational, political and societal challenges" associated with the pipeline '' along with the former German foreign minister Hans-Dietrich Genscher and Peter Sutherland, a former BP chairman '' puts the ex-Labour leader on a collision course with the Italian comedian Beppe Grillo, whose Five Star Movement (M5S) has been largely responsible for mobilising opposition to the project.
TAP's supporters claim that Grillo's movement ignores the views of the silent majority of people in Puglia. They point to a recent opinion poll commissioned by TAP that found the vast majority of people in the region do not believe the pipeline will have a harmful impact on their landscape. Many also believe it will help to drive down gas prices in Italy, where there is little competition in the energy market.
But the prospect of a David and Goliath battle with the olive growers in one of Italy's poorest regions threatens to be a PR headache for the consortium. Last December, senior TAP employees had to be escorted by 50 Italian military police when they addressed a packed meeting of angry people. Anti-TAP graffiti has appeared on walls in the region.
In a bid to enhance its image, this summer TAP sought to sponsor several festivals in Puglia's coastal region of Salento. "The company spent '¬365,000 sponsoring these festivals over many weeks," Hughes said. "People were furious when they realised what was happening and many artists '' including famous names in the region like Roi Paci, a trumpet player '' pulled out saying they would not play an event with TAP's name attached to it."
Building the pipeline is a key ambition for Aliyev. Analysts say he needs to start exporting Azeri gas to replace his country's rapidly declining oil income. Europe, in turn, will benefit by being less dependent on Russia for its energy supplies.
"This project is critical for Europe's energy diversity," said a spokesman for the consortium.
Blair's decision to take up the position has also proved controversial with human rights groups, who claim the pipeline will help to entrench the position of the Aliyev family, who treat Azerbaijan as their personal fiefdom.
The US State Department's human rights report for Azerbaijan last year noted that there have been "increased restrictions on freedoms of expression, assembly and association, including intimidation, arrest and use of force against journalists and human rights and democracy activists online and offline".
Requests for comment from Blair's office went unanswered.
In spite the sanctions, Russia's President Vladimir Putin continues expanding his sphere of influence, concludes an analysis of the Germanintelligence, published in German media.
According to Suddeutsche Zeitung, quoted by Deutsche Welle, the foreign policy committee in the Bundestag discussed Bulgaria and the Russian interests in the beginning of July.
In his article, the German investigative journalist Hans Leyendecker claims that at the session were invited the head of the German Federal Intelligence Service (BND) Gerhard Schindler and a BND analyst. They discussed the situation in Ukraine, Bulgaria and deliberated on Putin and the oligarchs.
According to Leyendecker, quoting one of the committee members, Schindler said Russia had an interest in the bankruptcy of Bulgaria, so it can reconnect closely with Russia.
Schindler said, according to the article, that Putin had an interest in weakening the Western democracy principles because in his opinion their individualism was wrong. The BND analysis claims Putin was trying to use the ''current weakness of the USA'' for his own goals and to impose a new global order, which was supposed to be established by around 2020. Putin was also trying to disunite Europe and to expand his spheres of influence. In Bulgaria and Serbia one could expect new developments.
#6Putin, the bloody bastard.Now he tried to collapse Bulgaria by blowing up the banks where all their gas partners have their money, not to mention a Russian bank is one of the major shareholders.
Grin grin.
#5sa-sha - 1 Aug 2014 // 10:49:08Oh, those damned Russians! Now they intend to bankrupt Bulgaria. And South Stream is their secret weapon ;-)
#4EDC - 1 Aug 2014 // 09:35:03A little reverse psychology show an interest at an auction of something you do not want or need knowing that others are watching and will bid to insure you do not get it ? Job done ?
#3Yane - 1 Aug 2014 // 00:48:37West=IMF=you must privatize, cut down on this, that, sell ur assets to the west, etc. etc. and in the end you wonder where your industry went, "don't blame us!" says the Kraut and tries to blame the Russians, what a joke! As if it's Russia's fault the "EU bliss" stinks!
#2We already knew as much, but it is good see it confirmed by some professional analysts. We have seen more people who wanted to adapt the world to their own ideas. The last two had a moustache.
Only difference might be that the two other ones genuinly believed in their ideas, and that this one is just looking for an ideology to fit his strategy.
#1What stuff do they take over there? Must be damn strong.
Bulgaria Sold Woodland to South Stream Despite Freeze of Activities
Bulgaria's Ministry of Agriculture has confirmed that 359 da of woodland were sold to South Stream Bulgaria in July.
The ministry's press office made the announcement after the investigative website Bivol.bg published a report on the deal.
The latest developments also came against the background of outgoing Prime Minister Plamen Oresharski's earlier assurance that activities on the construction of South Stream will be halted after the European Commission raised its doubts about the project's compatibility with the Third Energy Package and announced it would start an infringement procedure.
South Stream Bulgaria, a 50-50 joint venture of the Bulgarian Energy Holding (BEH) and Russian energy concern Gazprom, purchased the land for nearly BGN 10.78 M (EUR 5.51 M).
A square meter of the area was therefore worth EUR 15, below usual prices.
In comparison, First Investment Bank earlier paid BGN 207 (EUR 105) per square meter to buy land in the same region to later grant South Stream servitude to host the pipeline.
The area near the Black Sea city of was sold on July 21, just two days before the socialist-liberal cabinet stepped down.
Agriculture Ministry officials asserted all legal procedures had been observed during the deal.
They remind that South Stream's Bulgarian stretch was declared an object of national importance, a move the government made in 2011 to exempt the pipeline from a moratorium imposed on land within the A and B development zones near the Black Sea coast.
BRUSSELS - The European Court of Human Rights Thursday (31 July) told Russia to pay '¬1.86 billion to the shareholders of the disbanded Yukos oil group.
''The court decided that this amount should be paid by the Russian Government to Yukos's shareholders and their legal successors and heirs,'' it said in a statement.
The fine is the largest ever from the Strasbourg-based court, significantly more than its previous record of '¬90 million handed out in May against Turkey in case with Cyprus.
The court in September 2011 had already found Russia guilty for having violated rights in the European convention by imposing excessive penalties on Yukos and for not giving it enough time to mount a legal defence.
Thursday's decision aimed only to fix the amount of the fine on the three-year old verdict.
The court also ordered Russia to pay a '¬300,000 lump sum on top to cover the costs and expenses of the Dutch-based Yuko International Foundation.
The decision comes at a sensitive geo-political moment.
Russia's economy is already set to lose billions following Western-economic sanctions for its role in the conflict raging in eastern Ukraine.
Russia's ministry of justice said it ''does not view this ruling as an example of a fair and unbiased approach to the legal and factual circumstances of the case''.
It noted it could appeal the decision within three months.
Headed by former oligarch Mikhail Khodorkovsky, Yukos filed for bankruptcy in 2006 before being liquidated the following year.
Khodorkovsky, who now lives in Switzerland, spent nearly a decade in a Russian prison on charges of tax evasion.
Russian authorities said the former state-owned firm, which was privatised in 1995-6, was guilty of setting up sham companies to avoid paying taxes.
At the time, Yukos' assets were seized pending litigation, preventing the company from repaying the debts.
Russian authorities seized and auctioned off Yuganskneftegaz, a Yukos production subsidiary viewed as the group's only hope for survival.
When the group finally went bust in 2007, most of its assets were taken over by Rosneft, an energy giant run by an ally of President Vladimir Putin.
Lawyers representing Yukos had originally requested the Russian government pay '¬81 billion with daily interest but dropped it to '¬37.9 billion following the court's 2011 judgement on the violations committed.
The Strasbourg court on Thursday dismissed the Yukos argument that the violations alone led to the company's ultimate demise and confiscation of assets and so awarded them only '¬1.8 billon.
The decision comes on the heels of another much larger fine from an international arbitration court in The Hague earlier in the week.
In that case, Russia was fined '¬37 billion for having expropriated Yukos assets as part of a broader politically-motivated campaign of attacks against the company.
Over the past 6 months, there has been much talk about the strategic proximity between Russia and China, made even more proximal following the "holy grail" gas deal announced in May which would not have happened on such an accelerated time frame had it not been for US escalation in Ukraine.
And yet little has been said about that other just as crucial for the "new BRIC-centric world order" relationship, that between Russia and India. That is about to change when yesterday the Russian central bank announced that having been increasingly shunned by the west, Russia discussed cooperation with Reserve Bank of India Executive Director Shrikant Padmanabhan. The punchline: India agreed to create a task group to work out a mechanism for using national currencies in settlements. And so another major bilateral arrangement is set up that completely bypasses the dollar.
From the Russian Central Bank:
First Deputy Chairman of the Central Bank of the Russian Federation KV Yudaeva and Executive Director of the Reserve Bank of India G. Padmanabhan at the twentieth meeting of the Subgroup on banking and financial issues of the Russian-Indian intergovernmental commission on trade-economic, scientific-technical and cultural cooperation discussed the current state and prospects of cooperation between banks.
The meeting was attended by representatives of central banks, ministries and agencies, credit organizations in Russia and India.
During the meeting dealt with the problems faced by the branches and subsidiaries of banks in the two countries and ways of addressing these problems.
As a priority area discussed the use of national currencies in mutual settlements. Given the urgency of the issue and the interest of commercial structures of the two countries, the meeting decided to establish a working group to develop a mechanism for the use of national currencies in mutual settlements. It will consist of representatives of banks and, if necessary, the ministries and departments of the two countries to coordinate its activities will be central banks of Russia and India.
What is curious is that now that China has sided firmly with Russia when it comes to geopolitical strategy (not least when it comes to recent development surrounding the downing of flight MH-17, recall "China Blasts "One-Sided Western Rush To Judge Russia" Over MH17"), and thus Russia behind China when it comes to claims by the world's most populous nation in its territorial dispute with Japan, Japan too is scrambling to secure a major ally in Asia, and it too is trying desperately to get on India's good side.
Bloomberg reports that "Japan's Sasebo naval base this month saw unusual variety in vessel traffic that's typically dominated by Japanese and U.S. warships. An Indian frigate and destroyer docked en route to joint exercises in the western Pacific."
The INS Shivalik and INS Ranvijay's appearance at the port near Nagasaki showed Japan's interest in developing ties with the South Asian nation as Prime Minister Shinzo Abe's government faces deepening tensions with China. Japan for the third time joined the U.S. and India in the annual ''Malabar'' drills that usually are held in the Bay of Bengal.
With Abe loosening limits on his nation's military, the exercises that conclude today showcase Japan's expanding naval profile as China pushes maritime claims in disputed areas of the East and South China Seas. For newly installed Indian Prime Minister Narendra Modi, Japan's attention adds to that of China itself, in an opportunity to expand his own country's sway.
Japan's involvement in Malabar underscores its interest in helping secure its trade routes to Europe and the Middle East. The Indian Ocean is ''arguably the world's most important trading crossroads,'' according to the Henry L. Stimson Center, a foreign policy research group in Washington. It carries about 80 percent of the world's seaborne oil, mostly headed to China and Japan.
...
''The Japanese are facing huge political problems in China,'' said Kondapalli in a phone interview. ''So Japanese companies are now looking to shift to other countries. They're looking at India.''
So on one hand Japan is rushing to extend a much needed olive branch by the "insolvent western alliance + Japan" to India; on the other Russia is preparing to transact bilterally with India in a way that bypasses the dollar.
Which means that just as Germany has become the fulcrum and most strategic veriable in Europe (more on this shortly) whose future allegiance to Russia or the US may determine the fate of Europe, so suddenly India is now the great Asian wildcard.
Perhaps a very important hint of which way India is headed came moments ago from Reuters, which said that India has raised the issue of U.S. surveillance activities in the South Asian nation with Secretary of State John Kerry, the foreign minister said on Thursday. "Yes, I raised this issue (U.S. snooping) with Secretary John Kerry ... I have also conveyed to him that this act on the part of U.S. authorities is completely unacceptable to us," Sushma Swaraj said at a joint news conference in New Delhi. In response, Kerry said: "We (the United States) fully respect and understand the feelings expressed by the minister."
Thank you Snowden for helping move the geopolitical tectonic plates that much faster.
*We recently released Part 2 of this analysis. You can find it here.
Analysis SummarySince 2007, Al-Qaeda's use of encryption technology has been based on the Mujahideen Secrets platform which has developed to include support for mobile, instant messaging, and Macs.
Following the June 2013 Edward Snowden leaks we observe an increased pace of innovation, specifically new competing jihadist platforms and three (3) major new encryption tools from three (3) different organizations '' GIMF, Al-Fajr Technical Committee, and ISIS '' within a three to five-month time frame of the leaks.
Al-Qaeda (AQ) has been using encryption technology in various forms for a long time. The original Mujahideen Secrets is the most common one, but recently we've seen multiple new encryption products as well as adaptations to new platforms like mobile, instant messaging, and Mac.
The nature of these new crypto products indicates strategy to overlay stronger and broader encryption on Western (mainly US) consumer communication services. We do not find evidence of abandonment of US-based consumer communication services. Likely risks are still greater to hide outside the consumer crowd, and non-US-based services may be exposed to even stronger lawful intercept.
In this analysis using web intelligence (i.e. OSINT), we will explore AQ use of encryption and platforms '' as well as explore product developments following former NSA contractor Edward Snowden's disclosures.
Timeline of AQ Crypto Developments 2007 to NowThe Recorded Future timeline below lays out key developments from 2007 until now.
The original Mujahideen Secrets (Asrar al-Mujahideen) encryption software launched in 2007, primarily for use with email. Asrar has had multiple releases over time and is distributed by the Global Islamic Media Front.Asrar al-Dardashah, released by GIMF in February 2013, which is an encryption plugin for instant messaging based on the Pidgin platform '' which connects to major US-based platforms.Tashfeer al-Jawwal is a mobile encryption program, again from GIMF, released in September 2013, based on Symbian and Android.Asrar al-Ghurabaa is yet another alternative encryption program, however importantly, released in November 2013 by Islamic State Of Iraq And Al-Sham (ISIS), which coincides with ISIS breaking off from main AQ after a power struggle.Amn al-Mujahid is an alternative encryption program released in December 2013. In this case from Al-Fajr Technical Committee (FTC) which is also a mainstream AQ outfit.Below: The blue line in the middle of 2013 shows the approximate cut-off pre-/post-Snowden disclosures.
Click image for larger viewImpact of Edward Snowden DisclosuresLet's go back to the question of impact regarding the Edward Snowden disclosures. Did his massive release of secret documents lead to a change in communication behavior of terrorists, and maybe others?
Click image for larger viewThis analysis is only looking at a very small sliver of this, but the timeline above tells a compelling story showing how four to five months after the Snowden disclosures both mainstream AQ, as well as the break off group ISIS, launches three new encryption tools.
For additional analysis on this subject, be sure to read the research completed by the Middle East Media Research Institute (MEMRI).
*We recently released Part 2 of this analysis. You can find it here.
Who We AreWe are a start-up company headquartered in Cambridge, MA with offices in Arlington, VA and Gothenburg, Sweden. Our team includes computer scientists, statisticians, linguists, and technical business people with deep expertise in areas such as intelligence and security. We're committed to organizing the web in a radically new and useful way.
What We DoRecorded Future supports web intelligence from source collection and processing to analysis and reporting. Our patented web-based software empowers large organizations and government agencies interested in cyber security, corporate security, and competitive intelligence to anticipate risks and capitalize on opportunities.
Why We ExistOur mission is to organize open source information for analysis. Whether you're conducting intelligence research, competing in business, or monitoring the horizon for situational awareness, the web is loaded with valuable predictive signals. Our products help analysts across many industries make sense of the overwhelming trove of information.
Keith Alexander, the recently retired director of the National Security Agency, left many in Washington slack-jawed when it was reported that he might charge companies up to $1 million a month to help them protect their computer networks from hackers. What insights or expertise about cybersecurity could possibly justify such a sky-high fee, somewondered, even for a man as well-connected in the military-industrial complex as the former head of the nation's largest intelligence agency?
The answer, Alexander said in an interview Monday, is a new technology, based on a patented and "unique" approach to detecting malicious hackers and cyber-intruders that the retired Army general said he has invented, along with his business partners at IronNet Cybersecurity Inc., the company he co-founded after leaving the government and retiring from military service in March. But the technology is also directly informed by the years of experience Alexander has had tracking hackers, and the insights he gained from classified operations as the director of the NSA, which give him a rare competitive advantage over the many firms competing for a share of the cybersecurity market.
The fact that Alexander is building what he believes is a new kind of technology for countering hackers hasn't been previously reported. And it helps to explain why he feels confident in charging banks, trade associations, and large corporations millions of dollars a year to keep their networks safe. Alexander said he'll file at least nine patents, and possibly more, for a system to detect so-called advanced persistent threats, or hackers who clandestinely burrow into a computer network in order to steal secrets or damage the network itself. It was those kinds of hackers who Alexander, when he was running the NSA, said were responsible for "the greatest transfer of wealth in American history" because they were routinely stealing trade secrets and competitive information from U.S. companies and giving it to their competitors, often in China.
Alexander is believed to be the first ex-director of the NSA to file patents on technology that's directly related to the job he had in government. He said that he had spoken to lawyers at the NSA, and privately, to ensure that his new patents were "ironclad" and didn't rely on any work that he'd done for the agency -- which still holds the intellectual property rights to other technology Alexander invented while he ran the agency.
Alexander is on firm legal ground so long as he can demonstrate that his invention is original and sufficiently distinct from any other patented technologies. Government employees are allowed to retain the patents for technology they invent while working in public service, but only under certain conditions, patent lawyers said. If an NSA employee's job, for instance, is to research and develop new cybersecurity technologies or techniques, then the government would likely retain any patent, because the invention was directly related to the employee's job. However, if the employee invented the technology on his own time and separate from his core duties, he might have a stronger argument to retain the exclusive rights to the patent.
"There is no easy black-and-white answer to this," said Scott Felder, a partner with the law firm Wiley Rein LLP in Washington, adding that it's not uncommon for government employees to be granted patents to their inventions.
A source familiarly with Alexander's situation, who asked not to be identified, said that the former director developed this new technology on his private time, and that he addressed any potential infractions before deciding to seek his patents.
But Alexander started his company almost immediately after stepping down from the NSA. As for how much the highly classified knowledge in his head influenced his latest creation, only Alexander knows.
In the interview, Alexander insisted that the cybersecurity technology he's inventing now is distinct enough from his work at the NSA that he can file for new patents -- and reap all the benefits that come with them. A patent prohibits any other individual, company, or government agency from using the underlying invention without a license from the patent holder.
But even if Alexander's new technology is legally unique, it is shaped by the nearly nine years he spent running an intelligence colossus. He was the longest-serving director in the history of the NSA and the first commander of the U.S. Cyber Command, responsible for all cybersecurity personnel -- defensive and offensive -- in the military and the Defense Department. From those two perches, Alexander had access to the government's most highly classified intelligence about hackers trying to steal U.S. secrets and disable critical infrastructure, such as the electrical power grid. Indeed, he helped to invent new techniques for finding those hackers and filed seven patents on cybersecurity technologies while working for the NSA.
Alexander used his influence to warn companies that they were blind to cyberthreats that only the NSA could see, and that unless they accepted his help, they risked devastating losses. Alexander wanted to install monitoring equipment on financial companies' websites, but he was rebuffed, according to financial executives who took part in the discussions. His attempts to make the NSA a cyber-watchdog on corporate networks were seen as a significant intrusion by government into private business.
Few, if any, independent inventors have seen such detailed, classified information about the way hackers work and what classified means the government has developed to fight them, all of which gives Alexander a competitive advantage in his new life as a businessman. That insider knowledge has raised eyebrows on Capitol Hill, where Rep. Alan Grayson (D-Fla.) has publicly questioned whether Alexander is effectively selling classified information in exchange for his huge consulting fee. (Bloomberg reported that the figure dropped to $600,000 after the $1 million figure raised hackles in Washington and among computer-security experts.)
Alexander said that his new approach is different than anything that's been done before because it uses "behavioral models" to help predict what a hacker is likely to do. Rather than relying on analysis of malicious software to try to catch a hacker in the act, Alexander aims to spot them early on in their plots. Only the market will tell whether his approach is as novel as he claims. (One former national security official with decades of experience in security technology, and who asked to remain anonymous, said the behavioral-model approach is highly speculative and has never been used successfully.)
The former NSA chief said that IronNet has already signed contracts with three companies -- which he declined to name -- and that he hopes to finish testing the system by the end of September.
"We've got a great solution. We've got to prove that it works," Alexander said. "It will be another way of looking at cybersecurity that gives us greater capabilities than we've had in the past."
Asked why he didn't share this new approach with the federal government when he was in charge of protecting its most important computer systems, Alexander said the key insight about using behavior models came from one of his business partners, whom he also declined to name, and that it takes an approach that the government hadn't considered. It's these methods that Alexander said he will seek to patent.
Alexander said that if he determines that he needs to use technology or methods that the NSA has patented, he will pay for a license, including for anything he helped to invent while he was in office and for which he doesn't own the rights. During his time at the NSA, Alexander said he filed seven patents, four of which are still pending, that relate to an "end-to-end cybersecurity solution." Alexander said his co-inventor on the patents was Patrick Dowd, the chief technical officer and chief architect of the NSA. Alexander said the patented solution, which he wouldn't describe in detail given the sensitive nature of the work, involved "a line of thought about how you'd systematically do cybersecurity in a network."
That sounds hard to distinguish from Alexander's new venture. But, he insisted, the behavior modeling and other key characteristics represent a fundamentally new approach that will "jump" ahead of the technology that's now being used in government and in the private sector.
Alexander said he was persuaded to start a security business and apply for patents after hearing from potential customers, including company executives, who said they were worried about hackers who could steal or even erase the proprietary data on their companies' computers. Alexander said they were particularly worried about threats like the Wiper virus, a malicious computer program that targeted the Iranian Oil Ministry in April 2012, erasing files and data.
That will come as a supreme irony to many computer security experts, who say that Wiper is a cousin of the notorious Stuxnet virus, which was built by the NSA -- while Alexander was in charge -- in cooperation with Israeli intelligence. The program disabled centrifuges in a nuclear plant in Iran in a classified operation known as Olympic Games. The United States has never acknowledged its involvement.
The United States isn't the only government capable of building data-erasing malware. Iran is building a formidable cyber-army, U.S. intelligence officials say, and is believed to be behind a 2012 attack on an oil company in Saudi Arabia that erased data from more than 30,000 computers. Iranian hackers also launched a series of cyberattacks on major U.S. bank websites the same year, intelligence officials say. The strike took Washington by surprise because it was so sophisticated and aggressive. The hackers hijacked data centers consisting of thousands of computers each and used them to flood the bank websites with digital traffic, causing them to crash.
Much ado today about Pierre Omidyar's nine month update on his strategy for First Look Media. Gone is the grand plan to create a stable of digital magazines, and in its place a greater focus on building tools for journalists. Omidyar insists, however, that his two already announced blogs '-- John Cook's The Intercept and Matt Taibbi's unnamed project '-- will continue as planned.
We've seen this playbook before of course. A couple of years ago I wrote about ebook publisher, The Atavist's plans to pivot into a platform to allow others to publish. (They too promised they would maintain a commitment to also publishing their own material.) My thoughts on that move '-- outlined in a post subtly titled ''Platforms are for Pussies'' are equally relevant today'...
Every day another independent publisher pulls this same move: ''we're going to refocus on being a platform''. Evan Ratliff's Atavist has all but abandoned its original publishing model in favor of its ebook ''platform'', GOOD magazine has fired its entire editorial staff and will instead focus on being ''a platform for social good'' and now Punch! wants to help other publishers make it impossible for readers to click on articles about Mitt Romney.
ENOUGH.
I mean, I get it. Editorial is expensive. Christ, it's so expensive'... But it gets worse: Not only is editorial expensive, but nobody wants to pay for it. Readers, we're told, don't want to pay for it (I'll deal with that bullshit another time). And investors certainly don't want to pay for it'... No investor of sound mind thinks he or she will make money from a magazine, any more than they think investing in restaurants or airlines is a smart move.
A platform, on the other hand'... well, that's the answer to everything. Noone ever went broke building a platform. For one thing, a platform doesn't need to commission editorial: some other sap takes care of that '-- either clients (Atavist, Punch!) or Joe User (GOOD magazine).
Of course, in the case of first look, Omidyar is both sole investor and publisher. And apparently he's just realized that, even with a $250 million dollar budget and a big pile of NSA leaked documents acquired along with Glenn Greenwald, creating a serious journalistic enterprise is hard. A platform, on the other hand, is something Omidyar has built before and clearly believes he can build again. Someone else can take care of actually fixing American journalism and delivering on all the promises he made in his weirdly Pierre-centric launch video.
But while others discuss Pierre's pivot, and what it means for Greenwald's future at the project, there's another pivot tucked away in the announcement that most people seem to have missed. Here's the line (emphasis mine):
''[W]e've partnered with the talented Matt Taibbi to plan and launch this fall a new digital magazine with a satirical approach to American politics and culture.''
''A satirical approach to American politics and culture.''
Now compare that with Taibbi's original plan on joining First Look, as reported in the New York Times back in February'... (again, emphasis mine)
Mr. Taibbi will start his own publication focusing on financial and political corruption, he said in an interview on Wednesday. First Look is financed by the eBay founder Pierre Omidyar, who is worth $8.5 billion, according to Forbes. Mr. Omidyar has pledged $250 million to the project.
Even the Times couldn't resist pointing out the juxtaposition. Were we really supposed to believe that Taibbi would be allowed to investigate financial corruption, and Wall Street hi-jinx, when his boss is one of the richest men in America?
As Pando has written before, Omidyar has long been a critic of government wrongdoing, but when it comes to corporate America, he takes a firm ''don't ask, don't tell'' position. He once said that leakers of corporate documents should face the full force of the law, and that he'd be glad to hand one over to the cops should they approach him with stolen Wall Street secrets.
Today we have the answer: Apparently Taibbi will still be going after politicians and popular culture, but he'll have to find another outlet for his rightly celebrated take-downs of billionaires like the one who pays his salary.
(I emailed Taibbi a couple of hours ago for clarification. No reply as of press time.)
AFPOmidyar rethinks focus of online news ventureWashington (AFP) - Internet entrepreneur Pierre Omidyar is shifting the focus of his online news operation, saying he wants to "incubate" to improve journalism with new technology.
Omidyar, who created First Look Media last year, said his new go-slow approach will concentrate on two digital outlets -- The Intercept which launched with investigative journalist Glenn Greenwald, and a new "digital magazine with a satirical approach to American politics and culture" to be launched later this year, led by former Rolling Stone journalist Matt Taibbi.
"Rather than building one big flagship website, we've concluded that we will have greater positive impact if we test more ideas and grow them based on what we learn," Omidyar said in a blog post on Monday.
"We are unwavering in our desire to reach a mass audience, but the best way to do that may be through multiple experiments with existing digital communities rather than trying to draw a large audience to yet another omnibus site."
Omidyar said the project is "entering a phase that demands we spend more time and resources focusing on technology and how it can enhance the impact of journalism."
He said the effort will have its hub in San Francisco, "where we'll create an opportunity for technologists to break new ground."
He added that First Look has test-launched "a small, invite-only pilot fellowship program offering grants to incubate experiments to people who share our commitment to harnessing the potential of technology and journalism to serve the greater good."
Omidyar has pledged to invest some $250 million in the project to "empower" journalists and help them "pursue the truth."
First Look Media was established as a non-profit journalism entity, and Omidyar also plans a for-profit company to develop new media technology.
"At First Look we're not trying to replicate or make incremental improvements to existing approaches," Omidyar said in his blog post.
"We're trying to create a healthy future for journalism by supporting ventures and practices that empower citizens in new ways. As a startup journalistic venture built on experimentation, I believe we need to take a humble approach to our work and embrace experimentation and disciplined, continuous learning."
Omidyar said his editorial team now includes 25 journalists, and he expects to double that number by the end of the year. But he also said this is a long-term project.
"I expect we'll be in this planning, startup and experimental mode for at least the next few years as we explore how to become integrated into people's lives in meaningful ways," he said.
As Wells reported this morning, Senate Judiciary Committee Chairman Patrick Leahy unveiled his version of the NSA reform bill today. Leahy's bill is important because, well, it's not just Leahy's bill. It's the bill. It represents a compromise between the intelligence community, the administration more generally, civil liberties groups, industry, and fairly wide range of senators. And it will be the legislative vehicle that's going to move forward with the sometimes nose-holding support of most of the major parties. It thus warrants close attention.
Leahy's 97-page bill is decidedly tougher in its requirements on NSA than was the 43-page bill the House of Representatives passed back in May, the perceived laxness of which had drawn vociferous objections from civil libertarians. Leahy's bill, by contrast, has civil libertarian hearts aflutter. On Sunday, even before the bill's public release, the New York Times editorial page issued a ringing endorsement, commending it as ''a breakthrough in the struggle against the growth of government surveillance power.'' The ACLU also has endorsed the bill, in rather strong terms:
To put this in historical context: If the Senate passes the bill, it will be the first time since passage of the Foreign Intelligence Surveillance Act in 1978 that the chamber has taken action to constrain the intelligence community, and the first time Congress has a real shot at restoring the crucial privacy protections lost in the Patriot Act. To quote Joe Biden during the signing of the healthcare bill, ''This is a big f'--ing deal.''
But the administration also makes significant gains here. Most importantly, it codifies an authority that is now highly contested, and it pushes back a scheduled sunset of that authority that is approaching rather quickly.
In this post, we refrain from opining on the bill's merits and instead describe what it would do, how it differs from the House bill, and where in the bill lie the major advances that make the various parties with stakes in NSA reform all line up behind it.
Like the House bill, the Senate bill bans bulk collection under Section 215 of the Patriot Act. Section 101 of Leahy's Senate bill would, like its House counterpart, accomplish this by requiring that FISA business records applications'--whether for tangible things, call detail records, or something else'--be based on a ''specific selection term.'' And Section 101 would incorporate the same language the House bill set forth with respect to ordering production of information within two hops of a specific selection term: the government would be able to use (1) a specific selection term to order production of a first set of call detail records, the first hop; or (2) ''call detail records with a direct connection to such specific selection term'' to order production of a second set of call detail records, the second hop.
But ''specific selection term'' has a much narrower meaning in the Senate bill than in the House bill. Section 107 would define ''specific selection term'' generally as a term that ''specifically identifies a person, account, address, or personal device'''--which matches the House language. But the Senate definition goes on to require not only that a specific selection term ''limit the scope of information or tangible things,'' as the House bill would require, but that it should ''narrowly limit the scope of tangible things sought to the greatest extent reasonably practicable, consistent with the purpose for seeking the tangible things'' (emphasis added). What's more, the Leahy bill would exclude terms that do not narrowly limit in such a manner as specific selection terms. Examples of impermissible specific selection terms include terms ''based on a broad geographic region, including a city, State, zip code, or area code, when not used as part of a specific identifier,'' as well as terms ''identifying an electronic communication service provider . . . or a provider of remote computing service, when not used as part of a specific identifier . . . unless the provider is itself a subject of an authorized investigation for which the specific selection term is used as the basis of production.''
The tighter definition of ''specific selector requirement'' created a problem for the government: What happened, say, if the government knew a terrorist was staying a hotel and making calls from it, but didn't know which guest he was? Under these standards, it would not be able seek call detail records for all of the guests in the hotel. This is hardly bulk collection in the sense that worries Glenn Greewald and others, but would seem to be precluded by a law that restricts collection to the identification of individual accounts or people.
The Senate bill offers a novel solution to this problem, one based on minimization procedures. The House version directs the government to ''adopt minimization procedures that require the prompt destruction of all call detail records'' determined not to be ''foreign intelligence information,'' and Leahy's bill retains that common-sense requirement. Section 103 of the Senate bill, however, adds further minimization procedures for ''orders in which the specific selection term does not specifically identify an individual, account, or personal device.''
In other words, the government could get a block of call records from all guests at the hypothetical hotel, but in such cases, the law would require procedures that would ''prohibit the dissemination'' and ''require the destruction within a reasonable time period'' of ''any tangible thing or information therein that has not been determined to relate to a person'' belonging to a certain list'--including ''a subject of an authorized investigation,'' ''a foreign power or a suspected agent of a foreign power,'' or a person ''reasonably likely to have information about the activities of a subject of an authorized investigation.''
Section 101 goes on to introduce specific procedures for applications to obtain call detail records. As compared to the House bill, the Leahy bill would raise the bar on what such applications must state. In both versions, there are two general requirements: (1) ''reasonable grounds to believe'' the call detail records are relevant to an investigation; and (2) ''a reasonable, articulable suspicion'' that a specific selection term is associated with a foreign power.
The House and Senate agree as to the first requirement, both requiring that applications would have to state ''reasonable grounds to believe that the call detail records sought to be produced based on [a] specific selection term . . . are relevant to [an authorized] investigation.'' They differ, however, as to the second. Whereas the House version would require that there are ''facts giving rise to a reasonable, articulable suspicion,'' the Senate would demand simply ''a reasonable, articulable suspicion.'' More importantly, whereas the House version would require that there must be a reasonable, articulable suspicion that a specific selection term is ''associated with a foreign power or an agent of a foreign power,'' the Senate bill would require the specific selection term to be ''associated with a foreign power engaged in international terrorism or activities in preparation therefor; or an agent of a foreign power engaged in international terrorism or activities in preparation therefor'' (emphasis added). This would effectively limit call records acquisition to counterterrorism'--something the current 215 program is but the House bill would not have required in the future.
Not only would the Senate bill provide a higher application threshold than the House bill for call detail records, it would also contain more specific prohibitions than the House bill does concerning what a ''call detail record'' may include. Although both the House and Senate bills would specify that a call detail record may not include the address of a subscriber or customer, Section 107 of Leahy's bill clarifies that the term ''address'' is not confined to a mailing address: it can also be ''a physical address or electronic address, such as an electronic mail address, temporarily assigned network address, or Internet protocol address.''
Under current FISA, persons ordered to produce tangible things must also comply with ''nondisclosure orders,'' which may be challenged in certain circumstances. Section 104 would make it easier to challenge or set aside such nondisclosure orders. First, the provision would nix FISA's current ban on challenging a nondisclosure order for a one-year period after the issuance of the relevant production order. Second, the section would eliminate the Attorney General and FBI's ability to issue a certification'--which is treated as conclusive by a judge considering a petition to modify or set aside a nondisclosure order'--that disclosure may endanger the national security of the United States or interfere with diplomatic relations. Under current FISA, such a certification can all but end a judge's consideration of a challenge to a nondisclosure order.
Like the House bill, the Leahy bill contains protections for those ordered to produce tangible things or provide information, such as internet service providers. Section 105 immunizes such persons from liability, while Section 106 requires the government to compensate such persons for ''reasonable expenses incurred'' in complying with production orders.
Section 108 outlines the Inspector General's duties to audit the minimization procedures used in making production orders and to report the results of the audit.
Critically for the government, Title VII of the bill amends the Patriot Act sunset date from the middle of next year to the end of the 2017, harmonizing the business records sunset with those of the Section 702 authorities.
Put simply, there are wins and losses here for all sides (except industry, for which Title I is almost all win). Civil libertarians get a tighter definition of ''specific selection term'' over the House's version'--and various tightenings of other provisions as well. They get an end to bulk collection and a substantive rollback of the metadata collection. The administration, meanwhile, gets codification of its authority to do contact chaining using call records. And it gets relief from the fast-approaching 2015 sunset of the Section 215 authority. Industry, for its part, gets an important absence'--perhaps the biggest loss for the government in the entire legislation: The bill contains no requirement that telecommunications carriers retain call record data.
Title II deals with pen register and trap and trace devices under FISA. In similar fashion as Title I handles call records, Section 201 would ban bulk collection from such programs by imposing the requirement that ''a specific selection term . . . be used as the basis for the installation or use of the pen register or trap and trace device.'' Section 202 would demand privacy protections beyond those for which the House bill would provide.
Title V applies the ''specific selection term'' requirement to various other provisions in the U.S. Code that would otherwise permit the FBI to issue bulk collection national security letters. In Section 501, the Senate bill would, like the House bill, replace bulk collection with specific selection term requirements in four areas: (1) counterintelligence access to telephone toll and transactional records, 18 U.S.C. § 2709(b); (2) access to financial records for certain intelligence and protective purposes, 12 U.S.C. § 3414(a)(2); (3) disclosures to FBI of certain consumer records for counterintelligence purposes, 15 U.S.C. § 1681u; and (4) disclosures to governmental agencies for counterterrorism purposes of consumer reports, 15 U.S.C. § 1681v.
Section 502 of the Senate bill then goes further than the House bill by establishing circumstances under which persons issued national security letters may be subject to nondisclosure requirements. In brief, the bill would more or less forbid disclosure in instances in which the FBI certifies that failing to forbid disclosure could result in ''a danger to the national security of the United States''; ''interference with a criminal, counterintelligence investigation''; ''interference with diplomatic relations''; or ''danger to the life or physical safety of any person.'' However, the bill would permit persons subject to nondisclosure requirements to request judicial review.
Title III briefly touches upon Section 702 collection. Section 301 of the Senate bill tracks the House bill closely and would prohibit the use in trials, investigations, or regulatory proceedings of information obtained through procedures deemed by a FISA Court to be ''deficient.'' An exception to the rule would arise where the government ''corrects any deficiency'' and a FISA Court allows its use under minimization procedures. Curiously missing in Title III, however, is language present in the House version relating to minimization procedures for 702 collection. Whereas the House bill emphasized the need to ''minimize the acquisition, and prohibit the retention and dissemination, of any communication as to which the sender and all intended recipients are determined to be located in the United States at the time of acquisition,'' the Senate bill is silent.
The absence of any substantial change to 702 is a significant win for the administration.
Title IV of the Leahy bill offers three key reforms to the FISA Court system. First, Section 401 clarifies the role of a FISA Court-appointed amicus curiae. Civil libertarians had criticized the House bill for authorizing only an amicus presentation by non-government counsel, rather than creating a public advocate who could intervene on his own.
The Senate version also falls short of a full public advocate model but it goes further than the House bill, which made the appointment of amicus solely a function of the FISA Court's judgment in any given case. The Senate bill, by contrast, would require the FISA Court to consult with the Privacy and Civil Liberties Oversight Board (PCLOB) to ''jointly appoint not fewer than 5 attorneys to serve as special advocates.'' The bill then would require that the court ''shall designate'' one of the special advocates as an amicus to assist the court ''in the consideration of any certification . . . , or any application for an order or review that . . . presents a novel or significant interpretation of the law.'' But there's an escape hatch, one on which Steve Vladeck has written with respect to the House bill: the court can avoid designating an amicus by ''issu[ing] a written finding that such appointment is not appropriate.'' The language, in other words, still leaves the appointment of outside counsel up to the FISA Court, but it creates a stronger presumption in favor of outside involvement and involves the PCLOB institutionally in the appointment of special advocates.
Moreover, Section 401 affords the special advocate substantial duties and powers not present in the House bill. For instance, the amicus ''shall advocate, as appropriate, in support of legal interpretations that advance individual privacy and civil liberties'' and ''shall have access to all relevant legal precedent'' and any other materials that are relevant to the special advocate's duties. Moreover, the advocate ''may request that the court appoint technical . . . experts, not employed by the Government'' to ''assist'' the advocate. Both the special advocate and any experts appointed to assist the special advocate would have access to classified information, so long as they would be eligible for such access and access would be consistent with national security.
This is a mixed bag, in other words. Civil libertarians have gotten stronger presumptions of amicus participation, and they have won an institutionally stronger amicus in a number of ways. But the advocate is still an amicus and cannot intervene on his or her own authority.
Second, Section 401 would establish additional procedures for appellate review of FISA Court decisions. The Senate bill would require review by the FISA Court of Review in instances where an order addresses a ''question of law'' that potentially challenges the ''need for uniformity,'' as well as where such review ''would serve the interests of justice.'' In turn, the FISA Court of Review would be permitted to certify ''a question of law to be reviewed by the Supreme Court of the United States'' in any decision that approves a government application. Upon certification, the Court of Review would be able to designate a special advocate to provide briefing.
This is a big deal. For a number of reasons, the FISA Court has tended to be the final word on a lot of questions it considers. This will change that, involving more often the largely-dormant FISA Court of Review and potentially involving the justices in FISA interpretations from which they have always stayed away.
Finally, Section 402 of the Leahy bill would, like the House version, require the DNI to perform declassification review of any opinion that ''includes a significant construction or interpretation of law, including any novel or significant construction or interpretation of the term 'specific selection term.'' The DNI would be obliged to ''make publicly available to the greatest extent practicable'' all such opinions.
Finally, Title VI lays out a whole series of new disclosure obligations on the part of the government and gives companies permission to publish data about their interactions with the intelligence sector. Sections 601 and 602 require governmental disclosure of extensive data on the number of orders and certifications sought and received'--and estimates of the number of people targeted and affected by surveillance'--under a number of different FISA authorities. Section 603 gives companies ordered to produce material the ability to publish aggregated data on the number of orders they received. The disclosures contemplated by Title VI would add a significant amount of data to the public discussion'--significantly more than would the analogous provisions in the House bill. But at the same time, the bill would also exempt the FBI from several disclosure requirements. Still, Leahy's Title VI represents a significant win for civil libertarians and for industry, the latter of which has been itching to publish more data by way of alleviating overseas anxieties about the degree of its cooperation with NSA.
In short, the trade throughout this bill seems to be institutionalization of governmental authority in exchange for regulation the government will regard as burdensome and a great deal of transparency. Whether this works ultimately in favor of the government or the civil libertarians probably depends on whether industry ends up maintaining call records'--in which case the institutionalization of governmental access to them will probably prove more important than the added hurdles attached to that access. If, on the other hand, industry stops maintaining these records, government will have won the authority to access records that no longer exist.
Tangible | Define Tangible at Dictionary.comTangible definition, capable of being touched; discernible by the touch; materialor substantial. See more. ... (often plural) a tangible thing or asset. [C16: from ...tangible - definition of tangible by The Free DictionaryDefinition of tangible in the Online Dictionary. ... in the free online Englishdictionary and encyclopedia. tangible asset. ... (often plural) a tangible thing orasset.Tangible - Definition and More from the Free Merriam-Webster ...easily seen or recognized. : able to be touched or felt. Full Definition ofTANGIBLE. 1. a : capable of being perceived especially by the sense of touch :palpable.Tangible dictionary definition | tangible defined - YourDictionarytangible definition: The definition of tangible is being touchable or real. (adjective) An ... Tangible is defined as a real thing that can have value. An example of ...What is tangible product? definition and meaningwww.businessdictionary.com/definition/tangible-product.html- Cached - SimilarDefinition of tangible product: A physical item that can be perceived by the senseof touch. Examples of a tangible product include cars, food items, computers, ...Rule 34. Producing Documents, Electronically Stored Information ...(B) any designated tangible things; or ... The Committee, however, believes thatno amendment is needed, and that the proper meaning of ''designated'' as ...What is tangible and intangible? - Yahoo Answershttps://answers.yahoo.com/question/index?qid...- Cached - SimilarTangible things are objects (you can physically touch them). Intangible ... It justmeans it has no physical existence like emotions. Hope this ...What does tangible mean? definition, meaning and pronunciation ...www.audioenglish.org/dictionary/tangible.htm- SimilarProper usage and pronunciation (in phonetic transcription) of the word tangible.Information about tangible in the AudioEnglish.org dictionary, synonyms and ...tangible - Macmillan Dictionarywww.macmillandictionary.com/us/dictionary/american/tangible- Cached - SimilarWhat is tangible? tangible meaning and more by Macmillan Dictionary. ...business tangible properties or tangible assets are real things that a companyhas, ...What is TANGIBLE PROPERTY? - The Law DictionaryDefinition of TANGIBLE PROPERTY: Property which may be touched; such as isperceptible to the senses; corporeal property, whether real or personal.Searches related to definition of tangible things
A top National Security Agency offficial says there's less need now for the U.S. Government to cut a deal with leaker Edward Snowden than there was after his wave of surveillance disclosures began more than a year ago.
"As time goes on, the utility for us of having that conversation becomes less," NSA Deputy Director Rick Ledgett said during an appearance Saturday at the Aspen Security Forum. "It's been over a year since he had access to our networks and our information so the need for us to understand that greater level of detail is lesser and lesser."
Ledgett was the first U.S. official to public discuss the possibility of amnesty or leniency for Snowden, telling "60 Minutes" in an interview aired last December that it was "worth having conversations about" such a deal if it could stem the tide of leaks. The discussion Saturday was framed slightly differently, focusing on obtaining a better idea of what Snowden copied from NSA systems and reportedly gave to journalists.
Ledgett's remarks signal that lawyers for Snowden might have a weaker bargaining position over time. However, the NSA official also suggested that the damage Snowden did to NSA operations will also diminish with time because terrorist groups and foreign militaries change their communication methods from time to time anyway.
"So, as time goes on, his information becomes less useful," said Ledgett, who was recently promoted after handling the NSA's response to the Snowden revelations.
The NSA official acknowledged that the impact of Snowden's leaks on the spy agency's ability to gather information was hard to measure, but he insisted it was serious.
"When people say there are no damages with the disclosures, they are categorically wrong,'' he said. ''Our hope is that they're not catastrophically wrong.....In some of these cases, our ability [to gather information] is a fingernail's breadth."
Still, Ledgett, said NSA is bringing in a lot of data and will continue to do so.
"It's not the end of the world. It's not the end of the SIGINT system," he said, using military lingo for NSA's main task, "signals intelligence."
Read more about: National Security Agency, Signals Intelligence, Edward Snowden, Rick Ledgett
Drawing of the Foreign Intelligence Surveillance (FISA) Court at an Electronic Frontier Foundation (EFF) event in Germany last year. Photo via Flickr user mlcastle, original drawing by Lindsay Young
When the National Security Agency would like to take a look at all of the metadata of phone calls made by people using Verizon, a program revealed last summer by Edward Snowden, they must obtain approval from the secretive Foreign Intelligence Surveillance Court (better known as the FISA Court), which typically grants such requests. VICE has obtained disclosures that reveal for the first time since this program was made public that FISA Court judges have not only owned Verizon stock in the last year, but that at least one of the judges to sign off on the NSA orders for bulk metadata collection is a proud shareholder of the company complying with these requests.
On May 28 last year, Judge James Zagel, a FISA Court member since 2008, purchased stock in Verizon. In June of this year, Zagel signed off on a government request to the FISA Court to renew the ongoing metadata collection program.
He's not the only one. We filed a request to the courts for the personal finance statements for all of the FISA Court judges. About a month ago, federal judges began turning in their disclosures, which cover the calendar year of 2013. The disclosures show that FISA Court Judge Susan Wright purchased Verizon stock valued at $15,000 or less on October 22. FISA Court Judge Dennis Saylor has owned Verizon stock, and last year collected a dividend of less than $1,000. The precise amount and value of each investment is unclear'--like many government ethics disclosures, including those for federal lawmakers, investments amounts are revealed within certain ranges of value.
The FISA Court continually rotates with respect to how it deals with requests from the government. In essence, each judge takes turns overseeing surveillance asks from the Feds. Judge Roger Vinson, the judge who signed off on the order disclosed by Snowden last year, requested an extension for filing his personal finance statement. While it's not clear how the rotation schedule works, it's certainly plausible Judge Saylor or Judge Wright will soon be asked to renew the next request by the NSA for metadata from telecom companies.
Do the investments constitute a conflict of interest? Federal judges are bound by an ethics law that requires them to recuse themselves from cases in which they hold a financial stake in the outcome, or in cases in which their "impartiality might reasonably be questioned."
In the past, revelations about stock ownership have invalidated certain court decisions. For example, after an eye-opening investigation from the Center for Public Integrity, which revealed that a federal judge who participated in a mortgage foreclosure-related decision owned stock in Wells Fargo, a case was re-opened. The FISA Court is different. For one thing, FISA proceedings are ex parte, meaning Verizon isn't even a party for the NSA requests. However, telecom companies certainly have a stake in how they comply with government orders, and some ethicists say judges would be well served if they simply steer clear of these types of investments.
"I think prudence would suggest that a FISA judge would not acquire investments in these telecommunication stocks," says Professor William G. Ross, an expert on judicial ethics at Samford University's Cumberland School of Law in Alabama. "I'm not saying there is a conflict of interest, which my impression says there's probably not," Ross says, adding, "this is between what's improper and what's prudent."
District court clerks told VICE that judges typically do not offer responses on the record for these types of inquiries. Judge Saylor's office could not offer a comment, and a request for comment was also sent to the other judges.
Last year, Gawker reported that many FISA Court judges have owned various telecommunication stocks over the years. But the ethics forms we obtained show that since the Snowden revelation, FISA Court judges have been specifically purchasing and holding stock in the company that is the only named telecom giant known for its compliance with the NSA's bulk data orders.
Lee Fang, a San Francisco''based journalist, is an investigative fellow at the Nation Institute and co-founder of Republic Report.
WASHINGTON (AP) -- For months, CIA Director John Brennan stood firm in his insistence that the CIA had little to be ashamed of after searching the computers of the Senate Intelligence Committee. His defiant posture quickly collapsed after a devastating report by his own inspector general sided against the CIA on each key point of the dispute with the Senate.According to an unclassified summary of the report released Thursday, five agency employees - two lawyers and three computer specialists- improperly accessed Intelligence Committee computers earlier this year during a disagreement over interrogation documents. Then, despite Brennan ordering a halt to that operation, the CIA's office of security began an unauthorized investigation that led it to review the emails of Senate staffers and search them for key words.After Senate leaders learned about the intrusion in January and protested, the CIA made a criminal referral to the Justice Department, alleging improper behavior by Senate staffers. That referral, CIA inspector general David Buckley found, was based on inaccurate information and was not justified.When internal investigators interviewed three CIA computer specialists, they exhibited "a lack of candor," the IG report said.Those devastating internal conclusions prompted Brennan to abandon his defensive posture and apologize to Intelligence Committee leaders."The director said that wherever the investigation led, he would accept the findings and own up to them," said his spokesman, Dean Boyd, describing what has become a difficult moment for the nation's most prominent spy agency.Brennan has convened an internal accountability board chaired by former Sen. Evan Bayh, D-Ind., to examine whether any CIA officers should be disciplined.Furious Senate Democrats were unmoved, with some demanding further investigation and a public accounting from Brennan. By all accounts, the spying flap and the larger dispute over decade-old CIA interrogation practices have poisoned relations between key Democrats and the CIA.Two Intelligence Committee Democrats, Sens. Mark Udall of Colorado and Martin Heinrich of New Mexico, called on Brennan to resign."I just don't have a lot of confidence in his leadership," Heinrich said in an interview after leaving a briefing on the IG report."What's needed now is a public apology from Director Brennan to staff and the committee, a full accounting of how this occurred and a commitment there will be no further attempts to undermine congressional oversight of CIA activities," said Sen. Ron Wyden, D-Ore., an Intelligence Committee member."The investigation confirmed what I said on the Senate floor in March - CIA personnel inappropriately searched Senate Intelligence Committee computers in violation of an agreement we had reached, and I believe in violation of the constitutional separation of powers," Sen. Dianne Feinstein, the California Democrat who chairs the committee, said in a statement.At issue was a January search by agency officers of Senate computers for information gathered in the course of a Senate investigation into the CIA's interrogation techniques. The search involved a penetration of the Senate portion of a shared, classified computer network at a Northern Virginia facility that was being used to provide Senate aides access to millions of CIA documents.The fruits of the Senate's yearslong inquiry - a summary of a classified report on post-9/11 detentions and interrogations that accuses the CIA of misconduct - is expected to be made public soon.The CIA conducted the search after it began to suspect that Senate aides had obtained a draft internal review that the CIA believed the Senate was not entitled to see. The review included comments from CIA officers describing misgivings about the treatment of al-Qaida detainees.As it turned out, the Senate staffers got the review thanks to a glitch in the CIA's firewall, several officials said.The findings of the investigation by the CIA's inspector general were shared with the Justice Department, which declined to pursue criminal charges against the CIA employees, officials said.The inspector general concluded "that some CIA employees acted in a manner inconsistent with the common understanding" about the shared computer network, Boyd said.Boyd said there was no malicious intent behind the actions of CIA officers. He said they were trying to determine how privileged agency documents ended up on the Senate side of the CIA network and whether there was a security breach.The CIA is generally forbidden from conducting operations on U.S. soil. One reason no criminal charges were filed, said a Senate aide who was not authorized to speak publicly and requested anonymity, is that the Senate computers were on a CIA network subject to agency monitoring. But the CIA violated its agreement not to scrutinize the Senate side of the network.The summary of the inspector general's report does not say who ordered the CIA search of Senate computers or who conducted it. The Senate staff used the system to communicate about their investigation into what some call torture by CIA officers.Part of the CIA's computer surveillance, officials on both sides said, involved creating a fake Senate account to review what documents Senate staffers could access.On Tuesday, Brennan informed Feinstein and Sen. Saxby Chambliss of Georgia, the senior Republican on the committee, "and apologized to them for such actions by CIA officers as described in the (inspector general's) report," Boyd said.The move was a turnabout for the CIA director. After Feinstein complained in March about the CIA's penetration of committee computers, Brennan said, "When the facts come out on this, I think a lot of people who are claiming that there has been this tremendous sort of spying and monitoring and hacking will be proved wrong." He added, "We wouldn't do that."At the White House, spokesman Josh Earnest defended Brennan, pointing out that the CIA director "is the one who suggested that the inspector general investigate in the first place," and saying he continued to enjoy the president's confidence.
making a show of being morally superior to other people.Sanctimonious | Define Sanctimonious at Dictionary.commaking a hypocritical show of religious devotion, piety, righteousness, etc.: Theyresented his sanctimonious comments on immorality in America. 2. Obsolete.Sanctimonious - Definition and More from the Free Merriam-Webster ...www.merriam-webster.com/dictionary/sanctimonious- Cached - Similarpretending to be morally better than other people. Full Definition ofSANCTIMONIOUS. 1. : hypocritically pious or devout
Researchers have found that mutations in a gene that helps to cope with stress could increase the risk of suicide. Now they will try to develop a blood test to predict the risk.
Image: AfricaStudio/Shutterstock
Every 40 seconds someone in the world commits suicide. But a new discovery in the US by Johns Hopkins University researchers could help lower this statistic.
The researchers analysed 150 brain samples of deceased mentally ill and healthy people, including some of patients who had committed suicide. They discovered that all of those who had taken their lives had a mutation in the SKA2 gene.
This gene is expressed in the prefrontal cortex of the brain, and it determines how the brain reacts to stress hormones such as cortisol.
''If the gene's function is impaired by a chemical change,'' explains Caelainn Hogan from the Washington Post, ''someone who is stressed won't be able to shut down the effect of the stress hormone, which would be like having a faulty brake pad in a car for the fear centre of the brain, worsening the impact of even everyday stress.''
To confirm their results, the scientists analysed blood samples of 325 participants in the Johns Hopkins Center for Prevention Research Study, and found that those who had suicidal thoughts or had tried to commit suicide presented chemical alterations in the SKA2 gene.
And their blood test predicted with 80 to 90 percent accuracy whether a person had suicidal thoughts or had made an attempt to take their own life.
"We have found a gene that we think could be really important for consistently identifying a range of behaviours from suicidal thoughts to attempts to completions," psychiatrist and behavioural scientist Zachary Kaminsky, lead author of the study, said in a news release. "We need to study this in a larger sample but we believe that we might be able to monitor the blood to identify those at risk of suicide."
This study, which was published in the American Journal of Psychiatry, will help in the development of a blood tests that could predict if a person has mutations in the SKA2 gene and is prone to excess levels of stress and anxiety, which may lead to suicidal thoughts or attempts.
Blood test can predict risk of suicide - Telegraph
The gene is responsible for keeping levels of cortisol '' the stress hormone - under control.
"Suicide is a major preventable public health problem, but we have been stymied in our prevention efforts because we have no consistent way to predict those who are at increased risk of killing themselves," says study leader Dr Zachary Kaminsky, an assistant professor of psychiatry and behavioural sciences.
"With a test like ours, we may be able to stem suicide rates by identifying those people and intervening early enough to head off a catastrophe."
The blood test managed to predict those with the most severe risk of suicide with 90 per cent accuracy.
They could also spot if someone had already attempted suicide with 96 per cent accuracy, simply by looking at the levels of SKA2.
The SKA2 gene is found in the prefrontal cortex of the brain, and is involved in preventing negative thoughts and controlling impulsive behaviour.
If there isn't enough SKA2, or it is altered in some way, the body cannot control levels of cortisol. Previous research has shown that people who attempt suicide or who take their own lives have large amounts of cortisol in their systems.
A test could allow doctors or psychologists to place patients on 'suicide watch' and restrict their access to drugs or equipment which they could use to end their own life.
Dr Kaminsky said it could also help doctors know whether to give medications which are linked to suicidal thoughts.
"We have found a gene that we think could be really important for consistently identifying a range of behaviours from suicidal thoughts to attempts to completions," Kaminsky said.
"We need to study this in a larger sample but we believe that we might be able to monitor the blood to identify those at risk of suicide."
The research was reported in the American Journal of Psychology.
US scientists indentify 'suicide' gene - Latest News - Jamaica Observer Mobile
Thursday, July 31, 2014WASHINGTON, USA (AFP) -- US scientists have identified a gene mutation that appears to be common in people who attempt or commit suicide, a finding that could lead to a blood test to predict risk.
The discovery is based on a small study by researchers at Johns Hopkins University in Baltimore, Maryland and was published on Wednesday in The American Journal of Psychiatry.
"We have no consistent way to predict those who are at increased risk of killing themselves," said lead author Zachary Kaminsky, an assistant professor of psychiatry and behavioural sciences at the Johns Hopkins University School of Medicine.
"With a test like ours, we may be able to stem suicide rates by identifying those people and intervening early enough to head off a catastrophe."
Such a test is years away from being widely available to the public.
For now, researchers say they have found a chemical change in a single gene, called SKA2, which is linked to how the brain responds to stress hormones.
This gene "plays a significant role in turning what might otherwise be an unremarkable reaction to the strain of everyday life into suicidal thoughts and behaviours," said the study.
Researchers found it by examining brain samples from people who had killed themselves, and found that levels of SKA2 were significantly reduced compared to healthy people.
They also tested blood samples from 325 people in a prevention study at JHU and found that changes in the gene could predict with 80 per cent certainty those who were experiencing suicidal thoughts or who had attempted suicide.
Among certain groups, the accuracy of the test was even higher.
"Those with more severe risk of suicide were predicted with 90 per cent accuracy," said the study.
"In the youngest data set, they were able to identify with 96 per cent accuracy whether or not a participant had attempted suicide, based on blood test results."
The SKA2 gene works to inhibit negative thoughts and control impulsive actions. When there isn't enough of it, or it is altered, the brain releases abnormal levels of the stress hormone, cortisol.
Previous studies have shown that people who try to kill themselves, or who commit suicide, have an abnormal cortisol release.
Kaminsky said more research is needed to determine if a blood test could predict suicide in a larger group of people.
SHARE THIS: Please enable JavaScript to view the comments powered by Disqus.
ATHENS, Greece (AP) -- With the violence in Libya escalating to its worst level since the 2011 ouster of dictator Moammar Gadhafi, governments from around the world are scrambling to evacuate their citizens from the country, many seeking help from nearby Greece.A Greek government official told The Associated Press Thursday that a merchant vessel has been chartered by the Chinese government for the evacuation of "hundreds" of its citizens, but gave no further details. The official asked not to be named because details of the operation are still being finalized.According to the Greek Defense Ministry and other government officials, the Mediterranean country is also sending a navy frigate, Salamis, which was approaching Tripoli late Thursday, to pick up its embassy staff members as well as about 70 Greeks and dozens of others from China, Cyprus, Britain and Malta after their governments requested help.The evacuations have been triggered by clashes between heavily armed rival militias in Libya resulting in the worst violence since the civil war three years ago. After weeks of fighting nearly 100 people have been killed, 400 others wounded, and much of the airport in Tripoli has been destroyed.Many countries have suspended operations at their embassies in Tripoli, including Greece and the United States, and advised their citizens to leave the country."We're getting new requests for assistance all the time," the official said.The European Union said it was moving members of its border assistance mission and other staff in Libya to Tunisia. And earlier this week, Spain sent a military plane to pick up 60 people from Libya, while France sent two navy ships to collect 47 people, mostly French citizens.The Philippines' foreign secretary, Albert del Rosario, has said he will fly to Tunisia's Djerba Island near the Libyan border to help arrange the departure of about 13,000 Filipino workers from the Libyan cities of Benghazi and Misarata, as well as Tripoli.During the 2011 civil war, Greece assisted China and other countries in the Libya evacuation, basing many of its operations from the Mediterranean island of Crete, which is less than 300 kilometers (185 miles) from the east Libyan coast and has two international airports and a large hotel capacity.Regional authorities on the island said Thursday they were not aware of any new evacuation plans.---AP reporters Greg Keller in Paris, Juergen Baetz in Brussels, Patrick Quinn in Cairo, Jim Gomez in Manilla, Alan Clandenning in Madrid, Veselin Toshkov in Sofia and others contributed to this report.
Oil collected from hand cooped oil wells on the shore of Kyauk Phyu in western Myanmar
Myanmar is a country rich in natural resources, including minerals, oil, and gas. Yet during the half-century of military junta rule, only a small number of elite families prospered from the country's natural endowment.
President Thein Sein, who took office in March 2011, today pledged more transparency and economic reform to benefit the population broadly. Yet it remains to be seen whether his policies can live up to his promises.
One crucial area to watch is the auctioning off of onshore and offshore oil and gas exploration rights. In the past year, Myanmar has awarded 36 major oil and gas blocks to 47 companies, including both local and international corporations. But little information is publicly available about the owners and ultimate beneficiaries of these companies'--raising concerns about secrecy and the potential for kickbacks, money laundering, and other forms of corruption.
In an attempt to obtain information about ownership structures, the London-based watchdog NGO Global Witness contacted each of the 47 companies awarded oil and gas blocks. Only 13 have replied.
A few are publicly listed companies, including Royal Dutch Shell (RDS/A) and Italy's Eni (E). But details are scant about most of the others. Global Witness's full report (PDF) is available online.
As the report concludes, ''In a country with a long history of corruption in the natural resource sector, such secrecy poses serious questions as to who will reap the benefits of these resources.'' Noting an unfortunate pattern globally, the report adds: ''Secret company ownership structures are used as getaway cars for corrupt politicians, warlords and money-launderers all over the world.''
* Sale part of Italy's push to sell state assets (Adds details and background of planned sale)
By Steve Scherer
ROME, July 30 (Reuters) - Italy's Cassa Depositi e Prestiti (CDP) said on Wednesday its board had approved the sale of a 35 percent stake in its energy grid holding company to China's State Grid Corp for no less than 2.1 billion euros ($2.8 billion).
State holding company CDP owns all of energy grid unit CDP Reti, which has a 30 percent stake in gas transport group Snam and will soon receive a similar stake in power grid Terna.
On Thursday, Italian Prime Minister Matteo Renzi will host the signing of the sale agreement between CDP and China's State Grid International Development Ltd (SGID), a wholly-owned subsidiary of China's state grid, according to a statement.
The planned sale is part of Italy's efforts to shed state assets to reduce the country's 2-trillion-euro public debt and raise funds to invest in infrastructure projects. It is also one of the biggest Chinese investments in Italy.
Italy's Treasury, which owns 80 percent of CDP, has pledged to raise the equivalent of 0.7 percent of GDP, or about 11 billion euros, from disposals this year of stakes in companies including air traffic control operator ENAV, and oil companies Eni and Enel.
The state lender's initial plan envisaged the sale of up to 49 percent of CDP Reti to raise some 3 billion euros. The CDP board said it agreed to seek Italian institutional investors to buy another 14 percent of CDP Reti.
Italy has been urging China to invest more in Italy for a number years and Renzi visited the country last month to encourage investment.
Power and gas networks have become an attractive asset class in recent years as their return is regulated by governments, giving investors a predictable source of income even when the economy is struggling.
As part of the deal, CDP Reti will receive a loan of 1.5 billion euros prior to the sale, 45 percent from CDP and 55 percent from a pool of banks, the statement said.
When the sale is finalised in the coming months, SGID will be able to nominate two of CDP Reti's five board members and designate one board member for both Snam and Terna, according to the statement.
($1 = 0.7477 Euros) (Reporting by Steve Scherer; editing by David Clarke)
A worker walks on top of an oil tanker at Turkey's Mediterranean port of Ceyhan(Reuters)
A tanker carrying Kurdish oil has unloaded part of its cargo in the South China Sea, although the identity of the buyer remains a mystery.
The United Emblem Tanker had left the Turkish port of Ceyhan in June, carrying up to 1 million barrels of crude oil produced in Iraqi Kurdistan and exported by the autonomous region's government without permission from Baghdad.
It is one of three tankers that were loaded and sailed from Ceyhan in June.
A second tanker, the United Kalavrvta, has been anchored off the Texas coast for days amid a protracted legal dispute between Iraq and Kurdistan over the autonomous region's right to sell oil on international markets.
A US judge rejected a request from Baghdad that the US seize the tanker, saying that it was anchored outside of American territorial waters and did not fall under US jurisdiction.
The Kurdistan Regional Government filed a letter with the Texas court, stating that its sales of oil are in line with the Iraqi constitution.
Baghdad has launched a lawsuit against Turkey, accusing Ankara of assisting the Kurds to smuggle oil out of Iraq. It has threatened to pursue legal action against governments if they assist the Kurds with selling the oil.
A senior source at Marine Management Services said the ship-to-ship transfer involving the South China Sea cargo was sound, according to Reuters news agency.
The United Emblem tanker is "fixed to a legitimate charterer and performing legitimate operations", said Kostas Georgopoulos, as quoted by Reuters. He added that "the ship is still in international waters".
Reuters reported that the ship could have offloaded around half of its cargo onto another ship. The ships' destination remain unknown, as does the identity of the buyer.
The two commissioners in charge of the digital agenda, and youth and education, have written to to the EU's 28 education ministers, urging them to give every child the opportunity to develop basic coding skills at school.
Commissioner for the Digital Agenda Neelie Kroes, and Youth and Education Commissioner Androulla Vasiliou, wrote a letter to the EU's 28 education ministers, urging them to give every child the opportunity to develop basic coding skills at school.
In the letter, the commissioners state that children in the EU need to be better equipped to work in the digital era, at a time when youth unemployment is one of Europe's biggest challenges.
The Commission expects a shortage of 900,000 ICT practitioners in the European labour market by 2020.
But coding will not just support studies in maths, science, technology and engineering, the commissioners said.
"Coding will also directly help students to develop transversal skills such as analytical thinking, problem solving, team working, and creativity. Starting early means that they will be more inclined to consider computer science studies and ICT related careers," they wrote.
The Commission believes that "coding is the literacy of today" as every interaction on computers is governed by code. Basic coding skills will also be needed for many jobs in the near future and more than 90% of professional occupations nowadays require some ICT competence, though the number of graduates in computer science is not keeping pace with this demand for skills.
Coding has been taught in Estonian schools since 2012 while the UK will introduce programming in the national curriculum this year. France has also announced the introduction of an optional coding course in primary schools and Finland and Italy are considering coding initiatives for young people.
The European Union wants to know how far its national governments are willing to go to ensure that the euro area's new bank resolution authority has the funds it needs in an emergency.
As part of its drive to prevent future financial crises, the EU created the Single Resolution Mechanism for the euro area backed by a 55 billion-euro ($74 billion) fund to cover the costs of saving or shuttering banks. During the eight years when the fund is filling, or if even the full amount proves insufficient, it may need extra bridge-financing cash fast to get the job done.
The European Commission identifies three main options in a document circulated this week to EU governments and obtained by Bloomberg News. States could provide guarantees allowing the resolution fund favorable access to financial markets. Barring such common guarantees, which have little political support, countries could pledge the money needed on their own or through a pooled arrangement, according to the document.
Europe's Banking Union: Breaking Out of the Vicious Circle
At stake is the EU's drive to break the link between sovereign struggles and bank-sector woes, a major source of contagion during the euro-area financial crisis. When the resolution authority was created, nations agreed to provide bridge financing for the fund. Now the commission wants to clarify how that will work.
''A progressive pooling of credit lines would have the advantage that the sovereign-bank nexus would gradually weaken,'' and the resolution fund would enjoy ''more certain and swift'' access to emergency financing, the document states. Without such pooling, the targeted link between countries and their banks would remain.
'Credible and Strong'The banking sector would be responsible for paying back any debt issued by the resolution fund via the fees lenders will pay in over time.
''We would need something credible and strong for the immediate future,'' Portuguese Finance Minister Maria Luis Albuquerque said at a meeting with her EU counterparts in March. ''The stronger and the more credible it is, the less likely it becomes that we may actually need it.''
The bridge-financing debate is separate from talks on a possible public backstop that could be put in place after the resolution fund is filled.
The commission document asks countries whether they'd be willing to provide direct bridge financing, whether they'd support a system of guarantees for market borrowing and how they'd respond if a country couldn't meet its commitments.
Additional PressureThe board of the SRM, which assumes its duties in January 2016, could tap financial markets for as much as 20 billion euros during its start-up phase, according to a commission estimate of its stand-alone borrowing capacity.
Furthermore, it's impossible to know how much money might be needed during a crisis, according to the document. This means EU nations face additional pressure to find a strategy acceptable to voters and to financial markets.
''Irrespective of the option considered, it does not appear possible at this stage to make a reliable estimate of the amounts potentially needed for bridge financing,'' the document states. As a result, any financing ceiling ''must necessarily be the outcome of political rather than technical considerations.''
Countries face a trade-off between creating a reliable system and retaining the discretion to review all decisions before any funds are released, according to the document. If a member state doesn't deliver on its promised commitments, it could make it difficult for the fund to resolve a bank without hurting financial stability.
Non-Euro NationsWhen designing the financing mechanisms, the EU will need to consider how it will handle non-euro nations that sign their banks up for European Central Bank supervision, which begins in the euro area in November, and for the SRM. Bulgaria said it has approached the ECB, and Denmark is considering its options.
If the EU decides to use existing facilities to provide bridge financing, non-euro nations face significant drawbacks, according to the document.
Nations inside the euro zone could tap the 500 billion-euro European Stability Mechanism, which in addition to its sovereign bailout tool kit has the power to provide direct aid to banks or to offer targeted aid to a national government, as it did for Spain's financial sector.
The EU's balance-of-payments facility, which has offered rescues to non-euro nations, does not have such targeted powers, and the U.K. and Germany have blocked a bid to extend that fund's rescue options. Broader issues of capacity might also come into play.
''Existing sovereign backstops have limited resources which -- if used for banking resolution -- would not be available for more general financial needs in crisis situations,'' the document states.
To contact the reporter on this story: Rebecca Christie in Brussels at rchristie4@bloomberg.net
To contact the editors responsible for this story: Ben Sills at bsills@bloomberg.netPatrick Henry, Leon Mangasarian
2 August 2014Last updated at 13:54 By David LoynBBC News, KabulA recount of votes in the Afghan election has been suspended again, despite being scheduled to restart on Saturday after the Muslim Eid holiday.
The breakdown came despite late night phone talks between US Secretary of State John Kerry and candidates Abdullah Abdullah and Ashraf Ghani.
A spokesman for Mr Abdullah said that the UN had not taken his concerns into account.
Both candidates accuse each other of electoral fraud.
It was Mr Kerry's intervention last month in three days of talks in Kabul that led to agreement to carry out a full audit of votes.
The current dispute is over how to deal with ballot boxes found to contain invalid votes.
Mr Abdullah wants all of the votes thrown out if some in a box are found to be invalid. But the UN would prefer to discard individual votes not whole boxes.
The head of the UN in Afghanistan, Jan Kubis, said his team wants to count as many valid votes as possible, "thus honouring the courage and determination of the Afghans who voted in both rounds of the presidential election".
Continue reading the main storyAshraf GhaniAbdullah Abdullah Technocrat and former World Bank official. Open to talks with Taliban
Former anti-Soviet resistance member. Wary of Taliban talks
Leading in Pashtun-dominated southern provinces
Ahead in mainly Tajik northern areas
Backed by Rashid Dostum, an Uzbek ex-warlord accused of human rights abuses
Supported by wealthy Balkh governor Atta Mohammad, a bitter Dostum rival
Has support of Qayyum Karzai, brother of President Karzai
Also has backing of Mohamed Mohaqiq, powerful leader of ethnic Hazaras
Ahmed Zia Masood, whose brother was a famous resistance hero, helped balance ticket
Gul Agha Sherzai, an influential Pashtun, helped bring ethnic balance to ticket
Continue reading the main storyKarzai plan?Saturday was the date pencilled in Afghan diaries for the inauguration of a new president.
Instead President Hamid Karzai is still in power, as the long-running and bitter dispute over who won the election to succeed him continues.
International officials had been hoping that the recount would take three weeks.
Instead it looks as if it will take many months, and still there is no clarity over what the result will mean.
Part of John Kerry's deal involved both candidates accepting a government of national unity, with one as president and the other nominating a prime minister.
But there is no clarity over how far power-sharing would go.
Mr Abdullah's vice-presidential running mate, Mohammad Mohaqiq, has accused Mr Karzai of preventing Ashraf Ghani from agreeing to the deal, making his own continuation in office more likely.
Mr Mohaqiq said Mr Karzai would "get himself into a position where is seen as the best choice."
The fact is that neither candidate is happy with the idea of a national unity government.
Both have powerful backers to satisfy, and there are not enough big jobs to go round.
They accepted it to secure some progress. But the recount matters more than anything in determining how power will shift. And the recount is once again deadlocked.
The new US envoy for Afghanistan and Pakistan, Daniel Feldman, is visiting Kabul for the first time in his new role, and already dealing with a crisis.
This feels very dangerous in a country that has so often slipped into conflict in the past.
United Nations News Centre - Afghanistan: UN welcomes arrival of observers for audit of run-off election results
1 August 2014 '' The United Nations Assistance Mission in Afghanistan (UNAMA) welcomed today's deployment of international observers and UN experts ahead of the resumption Saturday of the comprehensive audit of the results of the Presidential election run-off held on 14 June.
''The arrival of a large contingent of international observers, in addition to the domestic observer groups, and UN experts is a powerful and tangible expression of the international community's commitment to Afghanistan,'' said Jn KubiÅ, the Secretary-General's Special Representative and head of UNAMA.
In a press release issued by the Mission, he said the deployment also reflects a deep desire by Afghanistan's international partners to respond to the two candidates' urgent request to ease the electoral impasse the country faced by helping Afghan institutions conduct a comprehensive and credible audit, in accordance with best international practice and under robust international supervision.
As agreed by the two Presidential candidates, Abdullah Abdullah and Ashraf Ghani Ahmadzai, on 12 July, the audit will be conducted by the Independent Election Commission (IEC) in the full presence of international and domestic observers, candidates' agents, the media and UN advisors.
More than 200 full-time international observers '' hailing from the European Union and including its Election Assessment Team and the American non-governmental organizations National Democratic Institute, Democracy International and Creative, as well as Asian Network for Free Elections '' will play a key role in providing complete international scrutiny of the audit, while dozens of experts from the UN Development Programme (UNDP) will be based in the audit warehouses where they will provide advice on international best practices and provide good offices for dispute resolution.
UNAMA noted that today's arrivals also include Jeff Fischer, a senior international expert on elections whose prior experience with the UN includes serving as chief electoral officer for the Popular Consultation for East Timor and heading the Joint Registration Taskforce in Kosovo.
In accordance with the parties' agreement, the audit process will be internationally supervised in a manner proposed by the UN in consultation with the candidates. Assisted by other UN experts, Mr. Fischer will perform such supervisory functions and work closely with and advise the Board of the IEC on international best practices as it makes decisions to validate, invalidate or recount ballots cast in the run-off.
Mr. KubiÅ called on the two presidential campaigns to honour their agreement to take advantage of the extensive international mobilization and goodwill through their participation in the fully transparent audit of every single ballot box which they themselves requested.
"Now that the complete regulatory framework for the audit is in place '...this unprecedented audit provides a credible mechanism to address the concerns of the parties and the people so as to ensure justice and the legitimacy of the result of the Presidential elections,'' Mr. KubiÅ said. ''It would be a disservice to the millions of ordinary Afghans who bravely voted across the two rounds if it is not made use of, if it is marred by further interruptions."
Under the 12 July technical agreement reached by the two candidates, the UN was asked to propose the manner for the international supervision of the audit, which involves the entirety of the approximately 23,000 ballot boxes from the run-off.
Any disputes or questions not responded to in a satisfactory manner in the audit will be referred to UN supervisors for advice or for resolution through its good offices.
The agreement also calls on the UN-mandated International Security Assistance Force (ISAF) to transport all the ballot boxes from the provinces to the capital, Kabul, with UN support. Accompanied by IEC officials, campaign agents and the Afghan security forces, to date ISAF and the UN have moved almost 75 per cent of the boxes to Kabul without incident.
SDR
Internationalists Are Pushing The World Towards Globally Engineered Economic Warfare
Over a year ago I published an essay entitled 'The Linchpin Lie: How Global Collapse Will Be Sold To The Masses'. This essay addressed efforts by the ever malicious Rand Corporation to create a false narrative surrounding the possibility of global collapse. Linchpin Theory, as it was named by it's originator and Rand Corp. employee, John Casti, is I believe the very future of propaganda. Every engineered crisis needs a clever cover story, and in Linchpin Theory, we are told that all human catastrophe is a mere natural product of the ''overcomplexity'' within various systems. Yes, there is no accounting of false flag geopolitics or elitist conspiracy, no acknowledgment of deliberately initiated chaos; such things do not exist in the world of ''linchpins''. Rather, the Rand Corporation would have us believe that the world is a massive game of Jenga, and the supporting pieces just remove themselves from the teetering structure by magical and coincidental causality.
Today, the linchpin lie is now being carefully inserted into the mainstream narrative. I can't say I was shocked to hear Alan Greenspan use its basic premise when he recently stated that:
''I have come to the conclusion that bubbles'...are a function of human nature. We don't have enough observations, but my tentative hypothesis to what we're dealing with is that both a necessary and sufficient condition for the emergence of a bubble is a protracted period of stable economic activity at low inflation. So it is a very difficult policy problem. I do believe that central banks that believe they can quell bubbles are living in a state of unrealism.''
It is important that we understand what Greenspan is actually doing here. The former Fed chairman is asserting that economic bubbles like the derivatives bubble of 2008 are a ''natural function'', like the seasons, and are out of the control of central bankers. The truth is that central bankers have never tried to ''quell'' economic bubbles, they have been deliberately creating them in order to position the global economy into a crisis which they can then exploit. Greenspan is not only diverting blame for all the past and future economic crashes central banks have engineered, he is also setting the propaganda stage for a great change in the dynamic of the central banking concept - what the IMF's Christine Lagarde calls the ''global economic reset''.
The current central banking structure gives the illusion of separation and sovereignty. Most people who have not researched the nature of the international banking cartel believe that the Federal Reserve, for instance, is a separate national entity from the Central Bank of Russia, or the Central Bank of China. They believe that these institutions act of their own accord rather than in concert with each other. The reality is, there is no Federal Reserve. There is no Central Bank of Russia. There are no separate entities. There are no Western banks and there are no BRICS. All of these banking edifices are merely front organizations for global financiers, as Council on Foreign Relations insider (and friend to the Rockefellers) Carroll Quigley made clear in his book, Tragedy And Hope:
"It must not be felt that the heads of the world's chief central banks were themselves substantive powers in world finance. They were not. Rather they were the technicians and agents of the dominant investment bankers of their own countries, who had raised them up, and who were perfectly capable of throwing them down. The substantive financial powers of the world were in the hands of these investment bankers who remained largely behind the scenes in their own unincorporated private banks. These formed a system of international cooperation and national dominance which was more private, more powerful, and more secret than that of their agents in the central banks. "
A ''global economic reset'', I suspect, will consist of a grand shift away from covert cooperation between central banks to an OPENLY centralized one world banking system, predicated on the concepts put forward by the IMF and led by the Bank of International Settlements, which has always been behind the scenes handing down commandments to the seemingly separate central banks of nations.
In order for this ''reset'' to be achieved, however, the establishment needs a historically monumental distraction. A distraction so confounding and terrifying that by the time the public has a chance to examine the situation rationally, the elites have already tightened the noose.
I have been warning ever since the beginning of the derivatives/debt collapse of 2007/2008 that the international financiers and globalists who created the artificially low interest rates and fiat lending bonanza would one day be required to fashion a considerably dangerous event in order to trigger the final collapse of the dollar based monetary system and replace it with a new currency (or basket of currencies), along with a new centralized financial authority.
This distracting event would have to rely on three very important strategies in order to succeed -
1) The use of what I call the ''scattershot effect''; a swarm of smaller crises growing exponentially until it blurs together to create one dynamic calamity.
2) The use of multiple false paradigms in order to confuse the masses and pit them against one another in an absurd fight over fake and meaningless causes.
3) The use of deceptive benevolence on the part of the financial elite as they tap dance in to act as global ''mediators'', ready to save the public from itself.
The end result would be a new brand of ''world war'' rather unique to history.
When most people imagine WWIII, they immediately envision images of nuclear bombs and mushroom clouds, however, I believe that when world war erupts, it may progress far differently from our cinematic assumptions. Regional conflicts are very likely, there is no doubt, but if one places himself in the shoes of the elites, one realizes that all out mechanized nuclear Armageddon is not really necessary to achieve the desired result of global governance.
Economic warfare alone could be extremely effective in initiating full spectrum fiscal implosion as well as mass starvation, mass panic, and mass desperation. All the signs lead me to believe that financial combat and 4th generation warfare will be used in the place of large armies and missiles.
The Scattershot Effect
Consider the sheer scope and number of crisis situations that have reached explosive proportions just in the past six months.
Syria continues to destabilize due to ISIS insurgents supported by the U.S., Saudi Arabia, and Israel; it is a horrifying storm which is now bleeding into other nations such as Iraq.
Iraq is on the verge of complete disintegration as the same western organized ISIS moves towards the outskirts of Baghdad.
Libya has imploded, with the American embassy evacuated, as well as the French and British, as various militias battle for supremacy.
The Ukraine crisis is nearing mutation into another beast entirely after the attack on Malaysian flight MH17. In just the past week, the EU has instituted sanctions against Russia, fighting has become even more fierce around Donetsk, Russia has been accused of firing artillery into Ukraine, and the U.S. now claims that Russia has violated the terms of the Intermediate Range Nuclear Forces treaty.
In the meantime, the Federal Reserve continues to taper QE3 while ignoring the unprecedented equities bubble they have birthed in the stock market, as well as refusing to answer the question as to who will actually buy U.S. Treasury debt if they do not? Our secret friend from Belgium? And what if this secret friend is, as I suspect, actually the IMF/BIS global loan shark duo? What then? Do we become yet another third world African-style debtor owing our very infrastructure to a financial bureaucracy on the other side of the world?
And what about the Baltic Dry Index, one of the few measures of global shipping demand that cannot be manipulated by outside money interests? Well, the BDI is back down to historic lows, falling 65% since January, signaling that the so-called ''economic recovery'' is not at all what it is cracked up to be.
Add to this the deluge of illegal immigration on the southern border, aided by the Obama Administration, as well as possible presidential impeachment and lawsuit proceedings, and you have a recipe for total chaos of the fiscal variety.
If the first six to seven months of 2014 have been this frenetic, how bad will the next six months be?
False Paradigms
We are all aware of the prevalence of the false Left/Right paradigm in American politics. Hopefully most people in the Liberty Movement understand, for example, that any impeachment or lawsuit proceedings against Barack Obama will be nothing more than a crafted circus designed to accomplish nothing '' a con game to placate conservatives with useless top-down solutions while the country burns around their ears.
There are other false paradigms that are not so clear to some, though...
The false Israel/Hamas paradigm has certainly duped a particular subsection of Americans and even a few patriots, even though it is historical fact that the creation of Hamas itself was funded and supported by the Israeli government. Why do Israeli politicians put money and arms at the disposal of Muslim extremist groups like Hamas and ISIS, only to enter into brutal conflict with them later? Could it be that the Israeli government does not have the best interests of the Israeli people at heart? Could it be that Israel is being used by internationalists as a catalyst for chaos? It is vital that we question the intentions behind such contrary actions in the Middle East.
Why has the U.S. government (Democrats and Republicans), Saudi Arabia, and Israel put support behind the ISIS caliphate in Iraq after spending decades of time, billions in resources, and thousands of lives, attempting to overrun and dominate the region? Why are these governments creating enemies that will later try to harm us?
It is all about false paradigms; dividing the masses into numerous conflicting sides and pitting them against each other when they should be fighting against the elites.
The false East/West paradigm is perhaps the most dangerous lie facing free men today. It is a lie that may very well define our generation if not our century. I have outlined in multiple articles the substantial evidence that proves beyond a doubt that Russia and China are members of the globalist agenda, and that the tensions between our two hemispheres are completely fabricated.
The latest announcement of a BRICS bank to rival the IMF is yet another scheme to perpetuate the illusion that the elites of these nations are at odds. In fact, the BRICS conference mission statement makes it clear that developing nations have no intention of breaking from the IMF (and certainly not the BIS). Instead, the BRICS bank is meant to provide ''leverage'' to ''force'' the IMF to become more inclusive, and hand over more power and participation. Vladimir Putin had this to say at the latest summit:
''In the BRICS case we see a whole set of coinciding strategic interests. First of all, this is the common intention to reform the international monetary and financial system. In the present form it is unjust to the BRICS countries and to new economies in general. We should take a more active part in the IMF and the World Bank's decision-making system. The international monetary system itself depends a lot on the US dollar, or, to be precise, on the monetary and financial policy of the US authorities. The BRICS countries want to change this.''
Brazilian President Dilma Rousseff insisted that the BRICS were not seeking to distance themselves from the Washington-based International Monetary Fund:
"On the contrary, we wish to democratize it and make it as representative as possible..."
Putin and the BRICS commonly rail against the ''unipolar'' financial system revolving around the U.S. dollar, but in the end they are only controlled opposition, and their solution is to place even more power into the hands of the IMF (a supposedly U.S. government controlled institution), creating a truly unipolar world order. If the U.S. loses its IMF veto status this year due to lack of allocated funds, and the BRICS dump the dollar as world reserve, this may very well happen.
As sanctions between Russia and the U.S. snowball, a perfect rationalization for a dollar decoupling will be created that very few people would have believed possible only a few years ago. It is only a matter of time before fiscal warfare escalates to destructive levels. Russia will inevitably cut off gas exports to the EU, and the BRICS will inevitably drop the U.S. dollar as a world reserve standard.
The U.S. relationship to the EU is also currently being presented as dubious, and this is not by accident. Failing relations between America and Germany are yet more theater for the masses to chew on. Western allies have been spying on each other for decades, but somehow the exposure of CIA activities in Germany is shocking news? The NY Fed suddenly attacks Deutsche Bank, seeking expanded monitoring and regulation? Germany's business interests are highly damaged by U.S. sanctions against Russia? It would seem as though someone is trying to create an artificial divide between elements of the EU and the U.S.
I believe that the narrative is being prepared for a faked financial breakup between the U.S. and many of its former allies, isolating the U.S., and destroying the dollar, but to what end? To answer that question, we must ask WHO ultimately benefits from these actions?
The Rise Of The Hero Bankers
In June of last year, the Bank of International Settlements, the central bank of central banks whose history began with the financial support of the Third Reich, released a statement warning that ''easy money'' from central banks was creating a dangerous bubble in stock markets around the world.
The IMF too has been pushing warnings of stock bubble collapse into the mainstream.
In June of this year, the BIS, a normally obscure and secretive organization, released another statement pronouncing that government had been led into a ''false sense of security'' by easy monetary policy and low interest rates, making the world economy perpetually unstable.
For an organization so covert and occult, the BIS sure has become rather candid lately. Frankly, I agree with everything they have said. However, I do not agree with the hypocrisy of the BIS, which dominates the decisions of all of its member banks, publicly criticizing policies which it most likely scripted itself. Why would the BIS suddenly denounce fiscal methods it used to promote? Because the BIS is setting itself up as the great prognosticator of a collapse that IT HELPED ENGINEER.
After the great financial war has subsided, and the people are suitably poverty stricken and desperate, it will be institutions like the BIS and IMF that swoop in to ''save the day''. Their offer will be to consolidate economic control into the hands of an elite group of bankers ''not affiliated'' with any particular nation state, thereby insulating them from "political concerns". The argument will be that national sovereignty is a bane on the back of humanity. They will claim that the catastrophe will continue until we ''simplify'' and streamline our economic and political systems. They will present themselves as the heroes of the age; the ones who predicted the crisis would occur, and the ones who had a solution ready to save the day (after sufficient death and destruction, of course).
As long as people remain obsessed with false paradigms and faux enemies, the establishment's goal of complete centralized dominance will be predictably attainable. If we change our focus to the internationalists as the true danger instead of playing their game by their rules, then things will become far more interesting...
You can contact Brandon Smith at: This e-mail address is being protected from spambots. You need JavaScript enabled to view it
Alt-Market is an organization designed to help you find like-minded activists and preppers in your local area so that you can network and construct communities for mutual aid and defense. Join Alt-Market.com today and learn what it means to step away from the system and build something better.
To contribute to the growth of the Safe Haven Project, and to help us help others in relocating, or to support the creation of barter networks across the country, visit our donate page here:
http://www.alt-market.com/donate
Silver and Gold are on their way back to historic highs, and now is the time to buy. Let LibertyCPM.com help you decide how to best protect your savings and insulate you from an ever destabilizing dollar.
Do you have enough Non-GMO seeds in case of economic collapse? Seeds are the OTHER alternative currency, and if you aren't stocked, then you aren't prepared. To buy top quality non-GMO seeds at a special 10% discount, visit Humble Seed, and use the code Alt10
According to exclusive information made available to To Vima, the USA has asked the Greek government for the permission to place a number of UAV drones on Crete for a period of six to twelve months.
The information suggests that talks on the critical matter began in January, with the American side pressuring the Greek government to transfer the drones by early June '' no agreement has been reached. The drones are part of the American strategy in tackling the rising terrorism in the Middle East and surrounding areas.
While the Greek government has had a close relationship with the USA, Prime Minister Antonis Samaras, the government Vice President Evangelos Venizelos and the Minister of National Defense Dimitris Avramopoulos have been hesitant to come to an agreement.
Aside from their fear of Greece potentially becoming a target for extremist groups, the government is keen to negotiate what it will receive in return. Military cycles have suggested that Greece is interested in receiving technical assistance, or may even receive surplus UAVs in order tackle illegal immigration.
BISHOPVILLE, S.C., July 31 (UPI) -- One man has been arrested and police are searching for another after a drone carrying marijuana, tobacco and cell phones was discovered next to the security fence of a prison in South Carolina.On April 21, prison officials discovered the downed personal drone near the perimeter of maximum-security Lee Correctional Institute near Bishopville, S.C.
Local police were able to trace the aerial transport to 28-year-old Brenton Lee Doyle, who was arrested and charged with drug possession and attempting to furnish contraband to inmates.
But security footage from a local convenience store revealed a second smuggler who appears to have bought many of items found with the drone. After months of searching, police are still unable to figure out his identity.
"As technology gets more advanced, we have to find more advanced ways to fight that,"Stephanie Givens, the Lee Correctional Institution spokeswoman told ABC News.
Givens declined to give specific model information about the drone, only saying it was "capable of flying long distances."
Although this is the first known incident of its kind in South Carolina, a less technologically advanced group of criminals in Georgia attempted a similar operation with a remote control helicopter in November 2013.
(C) 2014 United Press International, Inc. All Rights Reserved. Any reproduction, republication, redistribution and/or modification of any UPI content is expressly prohibited without UPI's prior written consent.
CONTINUATION OF THE NATIONAL EMERGENCY WITH RESPECT TO LEBANON
On August 1, 2007, by Executive Order 13441, the President declared a national emergency with respect to Lebanon pursuant to the International Emergency Economic Powers Act (50 U.S.C. 1701-1706) to deal with the unusual and extraordinary threat to the national security and foreign policy of the United States constituted by the actions of certain persons to undermine Lebanon's legitimate and democratically elected government or democratic institutions; to contribute to the deliberate breakdown in the rule of law in Lebanon, including through politically motivated violence and intimidation; to reassert
Syrian control or contribute to Syrian interference in Lebanon; or to infringe upon or undermine Lebanese sovereignty. Such actions contribute to political and economic instability in that country and the region.
Certain ongoing activities, such as continuing arms transfers to Hizballah that include increasingly sophisticated weapons systems, serve to undermine Lebanese sovereignty, contribute to political and economic instability in Lebanon, and continue to constitute an unusual and extraordinary threat to the national security and foreign policy of the United States.
For this reason, the national emergency declared on August 1, 2007, and the measures adopted on that date to deal with that emergency, must continue in effect beyond August 1, 2014. In accordance with section 202(d) of the National
Emergencies Act (50 U.S.C. 1622(d)), I am continuing for 1 year the national emergency with respect to Lebanon declared in Executive Order 13441.
This notice shall be published in the Federal Register and transmitted to the Congress.
Black smoke billowing from a storage depot of fuel that was hit by a rocket the night before near the airport in Tripoli on July 28th. Photo: EPA/SABRI ELMHEDWI
UPDATE: Germany pulled its embassy staff out of Tripoli on Monday, a day after advising all its citizens currently in Libya to leave the strife-torn country immediately.
"We have evacuated," a spokeswoman for the Foreign Office confirmed, adding that the German Embassy was still open.
A handful of staff are still working there. The Foreign Office did not say how many diplomats had been pulled out.
"The situation is extremely unpredictable and uncertain," the Foreign Office said on Sunday. "German nationals are at increased risk of kidnapping and attacks."
Two weeks of fighting between militias in Libya's capital Tripoli have left 97 people dead.
The United States evacuated its Libyan embassy staff under air cover Saturday as they faced a "real risk" from fierce fighting around Tripoli airport, Secretary of State John Kerry said.
The airport was closed on July 13th following clashes between armed groups in the area.
Britain later updated its advice to warn against travel to Libya, and told those already there to leave.
"British nationals in Libya should leave now by commercial means." Britain's embassy will remain open but with reduced staff, and its ability
to provide consular assistance "is very limited," the Foreign Office said.'High terror threat'
The British ministry warned of a high threat of terrorism, noting that a number of foreign nationals have been shot dead in recent months.
It told those still in Libya, believed to number between 100 and 300, to avoid demonstrations or large crowds and to "keep a low profile".
The US announcement that it was evacuating its embassy came hours after Libya's interim government warned that the clashes between militia vying for control of the strategic airport were threatening to tear the country apart.
Czech, Maltese and Austrian foreign ministries have ongoing advice not to travel to Libya.
Sweden, Denmark, Finland and Norway have all also advised against travel, while Sweden has also told its citizens to leave the second city of Benghazi.
Spain's foreign ministry "very strongly" recommends that all Spaniards leave Libya "immediately" and Switzerland has warned citizens that it would find it difficult to rescue them should the situation deteriorate.
Belgium on July 16th told nationals to leave the country "immediately" and Turkish citizens were advised to leave on July 24th, a day before its government suspended operations at the Tripoli embassy.
Austria, Italy and Portugal have all warned nationals against travelling around the country, with Austria saying that the risk of terrorist attack was particularly high in Benghazi.
Libya: western countries urge citizens to leave as civil war intensifies | World | The Guardian
Fighters from the Misrata brigade fire at Tripoli airport on Saturday amid turmoil in the Libyan capital. Photograph: AP
Western countries urged their citizens to leave Libya yesterday, as the country descended further into civil war and British diplomats came under fire.
As fighting raged across the country leaving 59 dead, Britain warned against travel to Libya, and told those already there to leave. "British nationals in Libya should leave now by commercial means," the Foreign Office said. Britain's embassy would remain open but with reduced staff.
France, Germany and the Netherlands issued similar warnings. "The situation is extremely unpredictable and uncertain," the German foreign ministry said. "German nationals are at increased risk of kidnapping and attacks."
Earlier on Sunday, a vehicle carrying a British diplomat was ambushed and sprayed with gunfire on the outskirts of Tripoli.
The armoured vehicle was evacuating British diplomats to neighbouring Tunisia and was attacked close to Camp 27, the base of an Islamist militia on the western outskirts.
Gunmen fired four rounds, all of them stopped by bullet-proof glass, and the vehicle, a white 4x4 with red diplomatic plates, was able to speed away. Ambassador Michael Aron later tweeted: "Shots were fired at our vehicles but all staff safe."
British security officers then warned a second convoy that was evacuating EU staff on the same coastal highway and it turned back, some of the staff later leaving Tripoli on an Italian air force transport plane.
On Saturday, the United States embassy had evacuated staff in the early hours of morning along the same road, with US jets orbiting above ready to strike militia. The decision had been taken after consultations with Washington. Memories are still fresh of the fate of the last ambassador, Chris Stevens, who died along with three staff when the US consulate in Benghazi was stormed by a militia two years ago.
With the American exit, the international community has more or less given up on a diplomatic solution. The Italian air force said it stood ready for more airlifts but EU ambassadors holding a crisis meeting on Sunday said no final decision on a total pullout had been reached.
Such an evacuation would be a severe loss of face, particularly for London and Paris, which led the Nato bombing of Gaddafi three years go and proclaimed at the time they had delivered democracy to Libya.
At Mitiga airport on Sunday waiting for the Italian air force flight, one foreign official said apportioning blame for why it all went wrong must wait for another time. "Today the priority is getting out."
Those evacuating leave behind a city in turmoil. For two weeks Tripoli has echoed to the drumbeat of artillery, tank fire and rockets as rival militias trade fire, much of it landing on innocent civilians. One rocket strike on a house killed 23 Egyptian workers on Sunday, and thousands more are fleeing their homes.
Similar scenes are taking place in the eastern capital, Benghazi, where air force jets allied with a former general, Khalifa Hiftar, pounded Islamist militia bases in battles that left 36 dead.
The battles are part of a wider struggle between Islamists and their opponents, triggered by elections in late June for a new parliament, the house of representatives, that saw steep losses for Islamist parties.
Those parties, including the Muslim Brotherhood's Justice and Construction party, will almost certainly lose control of the legislature, and their militias fear they will be dissolved.
In Tripoli, an alliance of Islamist and Misratan militias is focused on dominating the city and ejecting a militia from Zintan, which is allied with Hiftar.
The Zintanis hold the airport and a wedge-shaped area in the south and west, all of it now the scene of ferocious violence. Rockets and artillery are directed at the airport and half a dozen districts, with the Zintanis replying in kind. But much of the firing is wild, hitting homes and apartments.
Petrol is scarce, power is more off than on and the internet has been cut. In the absence of security forces, anarchy has broken out. Several banks have been raided by gangs armed with anti-tank rockets, blowing open safes to steal millions of dinars, and kidnappings are rampant.
Tripoli's main medical warehouse has been ransacked by one militia group, leaving hospitals running out of drugs at a time when they most need them.
Seraj, a hotel worker, said he drove from hospital to hospital looking for drugs for his friend, each time being told they had run out. "We tried four hospitals, all give the same answer, no drugs. I can't go to more hospitals, there is no petrol."
Meanwhile, the government has collapsed. On Thursday night, the prime minister, Abdullah al Thinni, was refused permission to board his own plane and leave the city for the east, by the militia that controls Mitiga, Tripoli's second airport. The main international airport is now a battered ruin.
VIDEO-CLIPS-DOCS
VIDEO- In Federal Court FBI Accused Of Cover Up In Oklahoma City Bombing! - YouTube
FLUORIDE TRUTH hits the TV in AUSTRALIA(25187 views) Uploaded 7/30/2014 11:16:33 PM by Permaculture88 (39 videos)Video InformationAustralia TV NEWS show exposes Fluoride for what it is - poison!Report from FLUORIDE RESEARCH on WATER FLUORIDATION & CRIME in the United States of America
If water fluoridation were ended, it might take a generation for the effects to recede.
If it continues to expand, the "signal" identified in this study may get lost in the "noise" of ENDEMIC VIOLENCE.
http://www.fluorideresearch.org
Video Keywords:water australia fluoride poison
Rate This Video: 0 ratings
Share this video on your site or blog. Just copy & paste one of the following: Is there something wrong with this video or viewer comment? Please let us know:Viewer Comments (0 total)Be the first to comment on this video.Related VideosRelated NaturalNews ArticlesRelated articles being calculated...Advertise with NaturalNews...
Support NaturalNews Sponsors:
Advertise with NaturalNews...
AUDIO-Big Data Firm Says It Can Link Snowden Data To Changed Terrorist Behavior : The Two-Way : NPR
hide captionThis photo provided by The Guardian in London shows Edward Snowden, who worked as a contract employee at the National Security Agency, in Hong Kong last year.
APThis photo provided by The Guardian in London shows Edward Snowden, who worked as a contract employee at the National Security Agency, in Hong Kong last year.
APFor nearly a year, U.S. government officials have said revelations from former NSA contract worker Edward Snowden harmed national security and allowed terrorists to develop their own countermeasures. Those officials haven't publicly given specific examples '-- but a tech firm based in Cambridge, Mass., says it has tangible evidence of the changes.
According to a new report to be released Friday by big data firm Recorded Future, a direct connection can be drawn: Just months after the Snowden documents were released, al-Qaida dramatically changed the way its operatives interacted online.
"We saw at least three major product releases coming out with different organizations with al-Qaida and associated organizations fairly quickly after the Snowden disclosures," said Recorded Future's CEO and co-founder Christopher Ahlberg. "But we wanted to go deeper and see how big those changes were."
By "product releases," Ahlberg means new software. And for the first time, Recorded Future says, it can now codify just how big a change it was.
The company brought in a cyber expert, Mario Vuksan, the CEO of Reversing Labs, to investigate the technical aspects of the new software. Vuksan essentially reverse-engineered the 2013 encryption updates and found not only more sophisticated software but also newly available downloads that allowed encryption on cellphones, Android products and Macs.
To put that change into context, for years, al-Qaida has used an encryption program written by its own coders called Mujahideen Secrets. It was a Windows-based program that groups like al-Qaida's arm in Yemen and al-Shabab in Somalia used to scramble their communications. American-born radical imam Anwar al-Awlaki used it, too. Since Mujahideen Secret's introduction in 2007, there had been some minor updates to the program, but no big upgrades.
Ahlberg thought the fact that the group changed the program months after Snowden's revelations provided good circumstantial evidence that the former contractor had had an impact '-- but he wanted to see how much.
As it turns out, Recorded Future and Reversing Labs discovered that al-Qaida didn't just tinker at the edges of its seven-year-old encryption software; it overhauled it. The new programs no longer use much of what's known as "homebrew," or homemade algorithms. Instead, al-Qaida has started incorporating more sophisticated open-source code to help disguise its communications.
"This is as close to proof that you can get that these have changed and improved their communications structure post the Snowden leaks," Ahlberg said.
Others are less sure that you can draw a straight line from Snowden to the changes in al-Qaida's encryption program. Bruce Schneier, a technologist and fellow at the Berkman Center at Harvard, said it's hard to tell.
"Certainly they have made changes," Schneier said, "but is that because of the normal costs of software development or because they thought rightly or wrongly that they were being targeted?"
Whatever the reason, Schneier says, al-Qaida's new encryption program won't necessarily keep communications secret, and the only way to ensure that nothing gets picked up is to not send anything electronically. Osama bin Laden understood that. That's why he ended up resorting to couriers.
Upgrading encryption software might mask communications for al-Qaida temporarily, but probably not for long, Schneier said.
"It is relatively easy to find vulnerabilities in software," he added. "This is why cybercriminals do so well stealing our credit cards. And it is also going to be why intelligence agencies are going to be able to break whatever software these al-Qaida operatives are using."
The NSA, for its part, declined to comment.
VIDEO-Dozens dead as Taiwan gas blasts rip up streets - CNN.com
Powerful blasts rip through southern Taiwanese city's streetsGas leaks are suspected as the cause of the explosionsAt least 26 people have died, with hundreds more injured(CNN) -- A downtown district of the southern Taiwanese city of Kaohsiung was ripped apart just before midnight Thursday by a series of explosions that killed at least 26 people and injured hundreds more, state news agency CNA reported.
The blasts, which were triggered by underground gas leaks, tore trenches through main roads, overturned cars and trucks, and sent flames leaping into the air in the city's Cianjhen district.
Witnesses said they saw vehicles flung into the air by the force of the explosions; one car was found on the roof of a three-story building.
Zong Han-Li was driving when the explosion happened directly in front of him, and his dashboard camera caught the moment the gas ignited.
Taiwan gas explosion
Taiwan gas explosion
Taiwan gas explosion
Taiwan gas explosion
Taiwan gas explosion
Taiwan gas explosion
Taiwan gas explosion
Taiwan gas explosion
HIDE CAPTION
"The video went black after a rock struck the dash cam and dislocated it," he told CNN. "I was scared that more rocks will follow, so I opened the door and looked around for help. I was very fortunate the driver's door was not stuck.
"The explosion left a trench 2 meters deep. Some vehicles were blasted into the air, and some people fell into the trench. It was a devastating scene.
Read: Gas explosions rip through city
"It was very loud when the explosion happened, (and) debris was blasted into the sky. Motorcycles were tossed as high as three stories. Everyone came out to help because there were already injuries."
Two people were blown to the roof of a four-story building, where emergency workers found them and took them to the hospital, CNA reported.
Firefighters from neighboring cities rushed to Kaohsiung to help battle several fires, which had been mostly contained by Friday morning.
Some vehicles were blasted into the air, and some people fell into the trench. It was a devastating scene.Zong Han-Li, witness
At least 26 people were killed, including four firefighters. Twenty-two emergency workers were among 267 people injured, officials said. A number of people were still missing, including a senior fire official who went to investigate reports of a gas leak.
As daylight broke, the extent of the damage became clear, with wrecked cars and motorcycles strewn across the cratered streets.
Dave Flynn, an English expatriate who has lived in the city for several years, visited the site of the explosions Friday morning. He said a huge trench had been gouged along the length of a main thoroughfare for several kilometers, and the pavement had been thrown to the side of the road, damaging vehicles.
Kevin Thom surveyed the damage hours after the explosions.
"There were police cordons on the major intersections, but they were just stopping vehicles," he said. "Most of the side streets, you could just walk into the area, and it was full of pedestrians checking out what had happened. I saw people fixing their own houses, and I saw the army arrive, some trucks to clean up some of the (wrecked) cars."
Schools and offices in the Cianjhen district, as well as in the neighboring Lingya district, were closed Friday to facilitate rescue efforts, Mayor Chen Chu said. Several schools and a cultural center are being used as emergency shelters.
Authorities suspect ethylene, propane or butane in the explosions. There are several petrochemical factories in the region.
The government called up hundreds of soldiers to assist in search and rescue efforts.
VIDEO- The President Delivers a Statement - YouTube
NEW: Dr. Kent Brantly visited with his wife, separated by glass wall, for 45 minutesBrantly is first known Ebola patient in U.S.Both Americans infected with Ebola will be treated at Emory University HospitalPlane will head back to Liberia for the second American patientAtlanta (CNN) -- A specially equipped medical plane whisked Ebola-stricken Dr. Kent Brantly from Liberia to Georgia on Saturday, setting up the latest leg of a race to save the man who's now the first known Ebola patient on U.S. soil.
An ambulance rushed Brantly -- one of two Americans seriously sickened by the deadly viral hemorrhagic fever last month while on the front lines of a major outbreak in West Africa -- from Dobbins Air Reserve Base to Atlanta's Emory University Hospital shortly after the plane landed late Saturday morning.
Video from Emory showed someone wearing a white, full-body protective suit helping a similarly clad person emerge from the ambulance and walk into the hospital.
Emory has said it will treat Brantly, 33, and, eventually, the other American, fellow missionary Nancy Writebol, in an isolation unit.
There, physicians say they have a better chance to steer them to health while ensuring the virus doesn't spread -- the last point nodding to public fears, notably expressed on social media, that the disease could get a U.S. foothold.
Tennessee doctor who worked with Ebola patients quarantines self
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
Ebola outbreak in West Africa
HIDE CAPTION
The plane, also equipped with a unit meant to isolate the patient, was able to take only one patient at a time. Organizers expect the plane will now pick up Writebol in Liberia, and bring her to Georgia early next week, said Todd Shearer, spokesman for Christian charity Samaritan's Purse, with which both Americans were affiliated.
Brantly's wife, parents and sister cried when they saw him on CNN, walking from the ambulance into the hospital, a family representative said on condition of anonymity. His wife, Amber, later said she was relieved that her husband was back in the United States.
"I spoke with him, and he is glad to be back in the U.S.," she said in statement sent to CNN. "I am thankful to God for his safe transport and for giving him the strength to walk into the hospital."
Brantly's wife visited with him from behind a glass wall for about 45 minutes, the family representative said. Kent Brantly was described as being "in great spirits and so grateful."
Brantly, who has ties to Texas and Indiana, and Writebol, of North Carolina, became sick while caring for Ebola patients in Liberia, one of three West African nations hit by an outbreak that health officials believe has sickened more than 1,300 people and killed more than 700 this year.
Treatment in isolation
This will be the first human Ebola test for a U.S. medical facility. But Brantly and Writebol will be treated at an isolated unit where precautions have been in place to keep such deadly diseases from spreading, unit supervisor Dr. Bruce Ribner said.
Everything that comes in and out of the unit will be controlled, Ribner told reporters Thursday, and it will have windows and an intercom for staff to interact with patients without being in the room.
Ebola is not airborne or waterborne, and spreads through contact with organs and bodily fluids such as blood, saliva, urine and other secretions of infected people.
There is no FDA-approved treatment for Ebola, and Emory will use what Ribner calls "supportive care." That means carefully tracking a patient's symptoms, vital signs and organ function and taking measures, such as blood transfusions and dialysis, to keep him or her as stable as possible.
"We just have to keep the patient alive long enough in order for the body to control this infection," Ribner said.
Writebol was given an experimental serum this week, Samaritan's Purse said, though its purpose and effects, if any, weren't immediately publicized.
The Ebola virus causes viral hemorrhagic fever, which refers to a group of viruses that affect multiple organ systems in the body and are often accompanied by bleeding.
Early symptoms include sudden onset of fever, weakness, muscle pain, headaches and a sore throat, but progress to vomiting, diarrhea, impaired kidney and liver function and sometimes internal and external bleeding.
Bruce Johnson, president of SIM USA, a Christian mission organization with which Writebol also is linked, said Saturday that Brantly and Writebol were seriously ill but stable.
"My last report (on Brantly) was yesterday. ... He was ambulatory, being able to talk, converse, and get up. So that was encouraging," Johnson said Saturday morning.
On Writebol, Johnson said: "She's responsive, and we're encouraged at how she's doing."
Emory's isolation unit was created with the Centers for Disease Control and Prevention, based down the road. It aims to optimize care for those with highly infectious diseases and is one of four U.S. institutions capable of providing such treatment.
The World Health Organization reports that the outbreak in Liberia, Sierra Leone and Guinea is believed to have infected 1,323 people and killed more than 729 this year, as of July 27.
'Compassionate' Brantly had focus in mission fields
Brantly went to Liberia with his wife and two children last year to serve a two-year fellowship with Samaritan's Purse.
Brantly was there initially to practice general medicine, but he focused on Ebola when the outbreak began, charity spokeswoman Melissa Strickland said.
He attended high school in Indianapolis before graduating from Abilene Christian University in 2003 and Indiana University's medical school in 2009.
While at Abilene Christian, he spent a summer interning overseas with an ACU program focused on vocational missions experiences, ACU's online alumni magazine reported.
"Everyone here who has been connected with Kent knows him to be someone who is very compassionate, considerate and always upbeat in all he does," the program's director, Dr. Gary Green, told the magazine. ".. Kent's the kind of guy who would weigh benefits versus risk, then try to take himself out of the equation so that he would be thinking, 'What do I bring to the table? Is the risk worth taking because I can benefit so many people?' "
Before heading to Liberia, Brantly did his residency at John Peter Smith Hospital in Fort Worth.
"We're kind of proud that there was a hero out there trying to do his best to make life better for other folks under the circumstances," a physician who knows him, Dr. Paul Pepe of Dallas' UT Southwestern Medical Center, told CNN affiliate WFAA this week.
Though Brantly's wife and children had been in Liberia with him, they were in the United States when he became ill, and they are not symptomatic themselves, the CDC has said.
Fear, conspiracy theories
As officials worked to bring Brantly and Writebol home, the idea of intentionally bringing Ebola into the United States has rattled many nerves.
"The road to hell was paved with good intentions," wrote one person, using the hashtag #EbolaOutbreak. "What do we say to our kids When they get sick& die?"
On the website of conspiracy talker Alex Jones, who has long purported the CDC could unleash a pandemic and the government would react by instituting authoritarian rule, the news was a feast of fodder.
"Feds would exercise draconian emergency powers if Ebola hits U.S.," a headline read on infowars.com.
Ribner repeatedly downplayed the risk for anyone who will be in contact with Brantly or Writebol.
"We have two individuals who are critically ill, and we feel that we owe them the right to receive the best medical care," Ribner said.
The fight against Ebola
All concerns about the United States pale in comparison to the harsh reality in the hardest-hit areas.
Even in the best-case scenario, it could take three to six months to stem the epidemic in West Africa, said Dr. Thomas Frieden, director of the CDC.
There's no vaccine, though one is in the works.
There's no standardized treatment for the disease, either; the most common approach is to support organ functions and keep up bodily fluids such as blood and water long enough for the body to fight off the infection.
The National Institutes of Health plans to begin testing an experimental Ebola vaccine in people as early as September. Tests on primates have been successful.
So far, the outbreak is confined to West Africa. Although infections are dropping in Guinea, they are on the rise in Liberia and Sierra Leone.
In the 1990s, an Ebola strain tied to monkeys -- Ebola-Reston -- was found in the United States, but no humans got sick from it, according to the CDC.
CNN's Chelsea J. Carter, Greg Botelho, Deanna Hackney, John Branch, Danielle Dellorto, Barbara Starr, MaryLynn Ryan and Ben Brumfield contributed to this report.
VIDEO-Archive: Colin Powell's UN Presentation on Iraq WMD pt 3 - YouTube
Submitted by Kyle Mantyla on Wednesday, 7/30/2014 2:37 pm
Rep. Michelle Bachmann has a new theory about the unaccompanied minors fleeing violence in Central America who have come in large numbers to the southern U.S. border: they are future victims of a liberal plot to use unwilling children for medical experiments.
It all starts with the case of Justina Pelletier, the teenage girl who was placed in the custody of the Massachusetts Department of Children and Families because of a dispute between Boston Children's Hospital and her parents, who were backed by other doctors from Tufts Medical Center, over her medical diagnosis.
Last month, she was finally returned to her family and now Bachmann has introduced legislation called "Justina's Law" that would prohibit "federal funding for medical experimentation on a ward of the State."
The narrative created by Bachmann and others within the Religious Right about this case asserts that the Boston Children's Hospital had received a federal grant to study somatoform disorder which prompted doctors to diagnose Pelletier with that condition so that the state could take custody of her and then use her as a guinea pig in the hospital's medical experiments.
This entire narrative is based on a bizarre misreading of the hospital's policy for allowing Wards of the state to participate in medical research trials, which is actually designed to protect such wards. The fact that Wards of the state can participate in medical trials under certain conditions and within specific guidelines is being intentionally misrepresented by Bachmann and others on the Right to claim that foster children are being used for wild medical experiments funded by grants from the federal government without oversight or limits.
Appearing on "WallBuilders Live" today to promote her law, Bachmann tied the issue to the debate surrounding the treatment of unaccompanied minors crossing the southern border, claiming that President Obama and the medical community want to bring tens of thousands of children from Central America into the United States so that they can be turned over to state governments and then used for medical experiments.
"Now President Obama is trying to bring all of those foreign nationals, those illegal aliens to the country and he has said that he will put them in the foster care system," Bachmann said. "That's more kids that you can see how - we can't imagine doing this, but if you have a hospital and they are going to get millions of dollars in government grants if they can conduct medical research on somebody, and a Ward of the state can't say 'no,' a little kid can't say 'no' if they're a Ward of the state; so here you could have this institution getting millions of dollars from our government to do medical experimentation and a kid can't even say 'no.' It's sick".
Ebola vaccine could be tested on people as soon as September, NIH saysAgency has been working on the Ebola vaccine over the last few yearsCDC raises travel alert for Guinea, Liberia, and Sierra Leone from level 2 to level 3(CNN) -- The National Institutes of Health will begin testing an experimental Ebola vaccine in people as early as September, the NIH announced Thursday.
The federal agency has been working on the Ebola vaccine over the last few years and says it has seen positive results when testing it on primates.
Dr. Anthony Fauci, director of the National Institute of Allergy and Infectious Diseases, said NIH has been working with the Food and Drug Administration to get the vaccine into early trials as soon as possible. According to NIAID, the results of the trial could come early next year.
The announcement comes the same day the Centers for Disease Control and Prevention raised its travel alert for Guinea, Liberia and Sierra Leone from level two to level three, warning against any nonessential travel to the region due to the Ebola epidemic. Since 2003, the agency has only issued level 3 alerts on two occasions: during the outbreak of SARS, severe acute respiratory syndrome, in 2003, and in the aftermath of the 2010 Haiti earthquake.
The CDC is sending 50 additional personnel to the three countries, CDC Director Dr.Tom Frieden said. They will be working to speed up laboratory testing, trace potentially infected people and strengthen the local health care systems.
Experts: The U.S. is ready for Ebola
Ebola is believed to have killed 729 people in Guinea, Liberia, Sierra Leone and Nigeria between March 1 and July 27, according to the World Health Organization. Stopping this particular epidemic could take months. "It's like fighting a forest fire," Frieden said. If you leave even one burning ember, the epidemic can start again.
This is not the first Ebola vaccine to be tested on humans and not the only treatment in the works. In March, a group at the University of Texas Medical Branch in Galveston, led by Thomas Geisbert, a professor of microbiology and immunology, was awarded a five year, $26 million grant to work with three promising Ebola therapies.
Geisbert is best known as the man who discovered an airborne strain of Ebola that infects only monkeys.
The grant covers three treatments that are thought to be the most promising - i.e. they have shown substantial ability to protect animals against Ebola in a laboratory setting, Geisbert said.
"So these treatments, one of these is actually a vaccine that works as a post-exposure treatment, much like the rabies vaccine when used here in the United States. Another is a small molecule inhibitor called a SIRNA. And the third is just conventional monoclonal antibodies. All of these have been able to protect nonhuman primates against Ebola when given after exposure."
The experimental vaccine Geisbert is working with has been nearly 100% effective in preventing infection in macaque monkeys, and also shows some effectiveness as a treatment when given soon after an exposure. In 2009, it was given to a lab worker in Germany after the worker reported being accidentally pricked with a needle. The worker did not develop Ebola, although it's not clear whether that's because of the vaccine.
Because of its strict rules and standards, the FDA can take years to get a vaccine to market. But it does makes exceptions to fast-track drug development, especially when it comes to deadly diseases like Ebola.
Geisbert said that's important, because unlike outbreaks of Ebola in the past, this epidemic is harder to manage
"I think it's very different, I mean historically outbreaks have occurred in central Africa and they have been relatively easy to contain," Geisbert said. "Usually, the outbreaks tend to occur in small villages, but it's controlled and kind of burns out. What we are seeing in West Africa here is completely different.
"They are having the virus occur simultaneously across a very large geographic area in different locations all at the same time. And that's very difficult to contain because again the organizations with the expertise in controlling these outbreaks, their resources are really spread thin."
The Ebola infection often is fatal. At this point, there are no vaccines that protect humans from the deadly virus. According to the World Health Organization, more than 1,300 people have been infected in West Africa in this recent epidemic. Public health officials have called this the worst Ebola outbreak in history.
Ebola outbreak: Is it time to test experimental vaccines?
CNN's Jacque Wilson contributed to this story.
VIDEO- New Law Requires Russian Bloggers To Register With The Government - YouTube
July 18, 2014Katie Pavlich talked about her book, Assault and Flattery: The Truth About the Left and Their War on Women, in which she argues that while'... read more
Katie Pavlich talked about her book, Assault and Flattery: The Truth About the Left and Their War on Women, in which she argues that while Republicans are constantly blamed for waging a war on women, the real war on women is being conducted by Democrats.'She argued that liberal heroes like Presidents Clinton and Obama were some of the worst offenders.'Ms.'Pavlich spoke at the Reagan Ranch Center in Santa Barbara, California. close
Javascript must be enabled in order to access C-SPAN videos.
*The transcript for this program was compiled from uncorrected Closed Captioning.
People in this videoHosting OrganizationSeriesRelated VideoFebruary 21, 2014Book Discussion on 11 Principles of a Reagan ConservativePaul Kengor, political science professor at Grove City College, talked about his book, 11 Principles of a Reagan'...
November 8, 2013Book Discussion on ExtortionPeter Schweizer talked about his book, Extortion: How Politicians Extract Your Money, Buy Votes, and Line Their Own'...
November 20, 2010Book Discussion on Leadership and CrisisLouisiana Governor Bobby Jindal talked about his book Leadership and Crisis (Regnery Press, 2010). It deals with his'...
January 22, 2010Book Discussion on Right NowThe Republican National Committee Chairman presented a 12-step plan on how to stop the major initiatives of the Obama'...
VIDEO-Protesters 'Rally Against the Banks' in Punta Gorda - WINK-TV News
PUNTA GORDA, Fla. - Picketers from across Florida gathered on the steps of the Charlotte County Justice Center Wednesday morning to have their voices heard.
"There's a lot of folks in foreclosure that need some relief," said Bradley Burdette, who organized the "Rally Against the Banks" protest.
One of those voices belonged to Ronald Gillis, who has been fighting to keep his house since 2008, when Deutsche Bank Trust Company Americas filed to foreclose on his Charlotte County home.
"If an entity suing me had the right to take my house, they should," Gillis said. "I have no problem with that."
Gillis said Deutsche Bank had no such right.
"It was a bank I'd never heard of before, and had no contact with and never did," he said.
While it is common and legal for mortgages to change hands between lenders before, and during the foreclosure process, Gillis and his fellow picketers say it's not fair. They are questioning the authenticity of the bank's documents in Gillis' case.
Wachovia was Gillis' original lender, when he bought his home in 2006. That bank dissolved during the recession in 2008, when it was bought out by Wells Fargo.
While Gillis' case has been winding its way through the circuit court for more than six years, he filed to have th case moved to federal court earlier this week.
VIDEO-CIA Director Brennan Denies Hacking Allegations - Council on Foreign Relations
A Conversation with John O. BrennanSpeaker: John O. Brennan, Director, Central Intelligence AgencyPresider: Andrea Mitchell, Chief Foreign Affairs Correspondent, NBC NewsMarch 11, 2014
Event DescriptionCIA Director John Brennan discusses the current challenges facing the intelligence community in a conversation with Andrea Mitchell of NBC News. Brennan denies that the CIA is trying to prevent the Senate Intelligence Committee from publishing the results of their investigation into the agency's controversial rendition, detention, and interrogation program. He also gives his perspective on the ongoing crises in Ukraine and Syria and the fallout from the Edward Snowden leaks.
Event HighlightsJohn Brennan on the allegations that the CIA may have searched and removed classified documents from computers belonging to Senate Intelligence Committee staff members:
"As far as the allegations of CIA hacking into Senate computers, nothing could be further from the truth. I mean, we wouldn't do that. I mean, that's'--that's just beyond the scope of reason in terms of what we would do."
John Brennan on whether Bashar al-Assad is likely to remain in power in Syria:
"Well, certainly I believe that Assad probably feels more confident as a result of some developments on the battlefield over the last year. I think initially, the forces were sort of struck pretty hard by the insurgency, and by the oppositionists. You know, Syria is a real army. It's been trained and equipped and outfitted by Russians for decades, and so, I mean, this is a large conventional military force with tremendous firepower. And I think the opposition deserves a fair amount of credit for staying in the game and bloodying the Assad military machine as much as it has."
John Brennan on the Russian intervention in Ukraine:
"And so is it possible'--does Russia have the capability to move into eastern Ukraine? Absolutely, they do, but I think what President Putin and others are doing right now is trying to determine exactly what they believe they need to do, as well as what they're willing to do, in light of such international condemnation of the Russian moves, whether or not they need to move in to Ukraine proper in order to protect their interests."
Terms of Use: I understand that I may access this audio and/or video file solely for my personal use. Any other use of the file and its content, including display, distribution, reproduction, or alteration in any form for any purpose, whether commercial, noncommercial, educational, or promotional, is expressly prohibited without the written permission of the copyright owner, the Council on Foreign Relations. For more information, write publications@cfr.org.
The Most:Subscribe to The World This WeekAsk CFR ExpertsWhat will be the effect of India's general election on relations with its neighbors, the EU, and the United States?
Asked by Najibullah Adamji, Mithibai College, Mumbai UniversityAnswered by Alyssa AyresAsk a Question
See all the questions and answers
New BooksMaximalistby Stephen SestanovichMaximalist finds lessons in the past that anticipate and clarify our chaotic present, revealing the history of U.S. foreign policy in an unexpected new light. More
By All Means Necessaryby Elizabeth C. Economy and Michael LeviThis clear and authoritative book presents a sweeping account of China's global resource quest and the unrivaled expansion of its economy. More
No Exit from Pakistanby Daniel S. MarkeyThe story of the tragic and often tormented relationship between the United States and Pakistan, and a call to prepare for the worst, aim for the best, and avoid past mistakes. More
View Complete List
Independent Task Force ReportsDefending an Open, Global, Secure, and Resilient InternetThis Independent Task Force report finds that as more people and services become interconnected and dependent on the Internet, societies are becoming increasingly vulnerable to cyberattacks.
New Council Special ReportsLimiting Armed Drone Proliferationby Micah Zenko and Sarah KrepsThe authors argue that it is essential to begin working now to expand and establish rules and norms governing armed drones, thereby creating standards of behavior that other countries will be more likely to follow.
Reorienting U.S.-Pakistan Strategyby Daniel S. MarkeyThe author examines Pakistan's complex role in U.S. foreign policy and advocates for a two-pronged approach that works to quarantine threats while integrating Pakistan into the broader U.S. agenda in Asia.
Afghanistan After the Drawdownby Seth G. Jones and Keith CraneThe authors assess the political, security, and economic challenges facing U.S. policymakers in Afghanistan and evaluate a range of policy options.
I don't want to understate how seriously wrong it is that the CIA searched Senate computers. Our constitutional order is seriously out of whack when the executive branch acts with that kind of impunity '-- to its overseers, no less.
But given everything else that's been going on lately, the single biggest '-- and arguably most constructive '-- thing to focus on is how outrageously CIA Director John Brennan lied to everyone about it.
''As far as the allegations of the CIA hacking into Senate computers, nothing could be further from the truth,'' Brennan told NBC's Andrea Mitchell in March. ''We wouldn't do that. I mean, that's just beyond the, you know, the scope of reason in terms of what we do.''
Earlier, he had castigated ''some members of the Senate'' for making ''spurious allegations about CIA actions that are wholly unsupported by the facts.'' He called for an end to ''outbursts that do a disservice to the important relationship that needs to be maintained between intelligence officials and Congressional overseers.''
And what compelled Senate intelligence committee chairwoman Dianne Feinstein to make a dramatic floor speech in the first place, bringing everything out in the open, was that Brennan had responded to her initial concerns not by acknowledging the CIA's misconduct '-- but by firing back with an allegation of criminal activity by her own staff.
Not coincidentally, the document the CIA was hunting for, that Senate staffers were accused of purloining, and that Brennan was now lying about, was a big deal precisely because it exposed more lies.
Known as the Panetta Review (evidently prepared for Leon Panetta, who served as CIA director from 2009 to 2011), it became relevant last year, when the CIA started pushing back against many of the scathing conclusions in the several-thousand page ''Torture Report'' the Senate staffers had finished up in December 2012.
Even as the CIA was officially rebutting key parts of the committee's report, the staffers realized they had an internal CIA review that corroborated them. In other words, it was proof that the CIA was now lying.
So what's in the Torture Report? Well, I can't quote from it, because the intelligence community and the White House have done such a good job of delaying its public release (although a redacted version is widely rumored to be coming soon).
But by all accounts, the report not only discloses abuse that was more brutal, systematic and widespread than generally recognized, but also chronicles how the people most intimately involved in the torture regime lied to others inside the CIA, lied to Justice Department lawyers, and lied to the public; how they lied about what they were doing, they lied to make it sound like it accomplished something, and afterwards, they lied some more.
Brennan reportedly told Feinstein and intelligence committee vice chairman Saxby Chambliss on Tuesday that he was sorry. But it's hardly the first time he's been caught in the act. There was, for instance, that time in June 2011, when he was President Obama's counter-terrorism advisor, that he asserted that over the previous year there had not been a single collateral death from drone strikes. (He later amended that to say there was no ''credible evidence'' of such deaths.)
But there was indeed ample and credible evidence. (Just as one example, a March 2011 CIA drone attack in Pakistan killed some 50 people, including tribal elders who were gathered for a tribal conclave.)
Brennan's erstwhile boss, Director of National Intelligence James Clapper, famously lied when he assured the Senate intelligence committee that the government wasn't collecting data on Americans in bulk when, as it turns out, it was.
Lying, of course, has always been a problem in Washington. But especially after the 9/11 terror attacks, the Bush-Cheney regime took lying to new post-Nixon heights. Maybe even pre-Nixon.
When I sat down to write my last ''White House Watch'' column for the Washington Post, what struck me most about the Bush years were the lies. The most consequential, of course, were the lies about the war. The most telling were the lies to cover up the lies about the war. And the most grotesque were the lies about torture.
The other thing is that there were no consequences. No one got in trouble for lying. The only semi-casualty was Scooter Libby, briefly convicted of lying while obstructing the investigation into vice president Cheney's lies.
Figuring out how to right the constitutional imbalance between the branches of government, as exposed by this CIA assault on Congress, is very complicated.
But doing something about lying isn't. You need to hold people accountable for it.
History will assuredly record that President Obama lied about a number of things, particularly as he carried water for the intelligence community and the military. But he's no Cheney.
So if you're the president, you fire everyone who lies. Starting with John Brennan.
VIDEO-Texas lab targets Ebola virus with work on vaccine
The Ebola virus is one of the deadliest on the planet and the current outbreak is the worst the world has seen since the virus surfaced in the late 1970s. VPC
Sherry Williams , KHOU-TV, Houston10:28 p.m. EDT July 29, 2014
This photo provided by the CDC shows an Ebola virus. U.S. health officials are monitoring the Ebola outbreak in Africa but say the risk of the deadly germ spreading to the United States is remote.(Photo: AP)
GALVESTON, Texas '-- The Ebola virus is one of the deadliest on the planet and the current outbreak is the worst the world has seen since the virus surfaced in the late 1970s.
Ebola causes organ failure and internal, as well as external bleeding. It is contracted by coming in contact with an infected person's bodily fluids.
So what is University of Texas Medical Branch Professor Thomas Geisbert doing with the virus in his Galveston lab?
"We're really trying to improve the vaccines, improve the treatments and really kind of support the efforts in that manner," said Geisbert of the school's Department of Microbiology and Immunology.
USATODAY
Ebola virus: What you need to know about the deadly outbreak
His efforts to create an effective vaccine are funded by a $26 million National Institutes of Health grant awarded collaboratively with Profectus BioSciences, Tekmira Pharmaceuticals Corp. and the Vanderbilt University Medical Center.
"We are the only academic university in the country right now that works with Biosafety Level 4 pathogens," Geisbert said.
Security at the hospital is off the charts.
"It's kinda like a box within a box within a box," he said.
Ebola originated in West Africa and has a 90% death rate. A naturalized U.S. citizen working in Africa recently died from the virus. A doctor from Fort Worth and a medical assistant in Liberia are fighting the virus there. Authorities say those U.S. connections have not endangered Americans.
USATODAY
American doctor's Ebola prognosis 'grave'
However the CDC is urging medical personnel worldwide, especially those who visit West Africa, to be on alert.
U.S. health experts want awareness about the disease to spread, not fear of catching it. There has never been a case of Ebola in a developed country.
Even though Ebola is deadly, it's also fragile. Disinfectants, soaps and detergents kill it. Presently in a UTMB lab, a Texas doctor and his team are hoping to eliminate it from the Earth.
Read or Share this story: http://usat.ly/1n0FDe2
VIDEO-Big Brother at Helsinki airport raises concerns among civil liberty groups | euronews, world news
Big Brother is watching you at Helsinki airport and tracking every move you make.
The decision to install sensors which will be linked to mobile phones turned on to the wi-fi mode has raised concerns with civil liberty groups.
The system is the first in the world which will track passengers' movements in real-time from the car park to the departure gate updating them with information.
''For us the main point is how to improve the customers' experience, to improve the enjoyment factor as well as improving the fluency of movement inside the airport,'' said Heikki Koski, deputy manager, Finavia the company which operates the airport.
Around 15 million passengers a year use the airport, Finland's largest and each one will be able to receive advertisements and marketing information if they choose to.
''Well it would interest and benefit me to know how much time I have to make it to the gate, but I can live without the advertisements,'' said one passenger.
The operators say all data which is gathered is in aggregated form and cannot be passed on.
''If the users will not be identified in this system, very few problems will arise, but if the users or anybody tracked in the airport can be connected to their identities then this system can become a threat to privacy,'' explained Ville Oksanen, researcher of technology justice, Aalto University
The technology was tested in a US department store where it was criticised for monitoring unwary customers.
The company behind the new service says passenger privacy is, ''extremely important'' to them and that ''the anonymous monitoring respects customers' privacy''.
VIDEO-CIA Admits To Spying On Senate Intelligence Committee | Crooks and Liars
In March, CIA Director John Brennan swore there hadn't been any hacks into the Senate Intelligence Committee's network. Today, the CIA issued a statement apologizing for his department's use of social engineering to gain access to the committee's computers.
New York Times:
An internal investigation by the Central Intelligence Agency has found that its officers improperly penetrated a computer network used by the Senate Intelligence Committee to prepare its damning report on the C.I.A.'s detention and interrogation program.
The report by the agency's inspector general found that C.I.A. officers created a fake online identity to gain access on more than one occasion to computers used by members of the committee staff, and tried to cover their movements as they rooted around the system, according to an official with knowledge of the investigation's findings.
A statement issued Thursday morning by a C.I.A. spokesman said that John O. Brennan, the agency's director, had apologized to the two senior members of the intelligence committee and would set up an internal accountability board to review the issue. The statement said that the board, which will be led by former Senator Evan Bayh, an Indiana Democrat, could recommend ''potential disciplinary measures'' and ''steps to address systemic issues.''
Wonkette lends a little perspective:
Criminy, you break into another branch of government's computers, steal their files, deny you did it, and then some time after being caught gigabyte-handed, you eventually apologize for doing it '-- what more do these raving privacy freaks want? Spies spy, that's their job, after all. It's not like they were doing something really against the Constitution, like trying to make sure that 501(c)(3) ''charities'' actually qualify for a tax break. Now, that's serious.
The Inspector General's summary can be read here.
Watch This Fox Pundit Call Out Tucker Carlson's 'Christian Nation' Hypocrisy On Refugee Kids
Obama says that after 9/11, 'we tortured some folks' | Video | Reuters.com
President Barack Obama said on Friday the CIA ''tortured some folks'' after the Sept. 11, 2001, attacks. Rough Cut (no reporter narration).
'² Hide Transcript
'¶ View Transcript
ROUGH CUT (NO REPORTER NARRATION) STORY: President Barack Obama said on Friday the CIA "tortured some folks" after the Sept. 11, 2001, attacks, and that the White House had handed over to Congress a report about an investigation into "enhanced interrogation techniques." "We did a whole lot of things that were right, but we tortured some folks. We did some things that were contrary to our values," Obama told a White House news conference. Obama's comment was a reaffirmation of his decision to ban the use of interrogation techniques such as waterboarding shortly after he took office in January 2009. The administration of President George W. Bush, Obama's predecessor, authorized the use of harsh questioning techniques of militant detainees in the wake of the 9/11 attacks after deciding they did not amount to torture. Obama told reporters the techniques were used because the United States was afraid more attacks were imminent. "It's important for us not to feel too sanctimonious in retrospect about the tough job that those folks had," he said. "A lot of those folks were working hard under enormous pressure and are real patriots." Obama also said he had full confidence in CIA Director John Brennan despite a revelation the agency spied on a U.S. Senate committee investigating its interrogation techniques
